ID: 1032141416

View in Genome Browser
Species Human (GRCh38)
Location 7:129334414-129334436
Sequence TAACTAGGAGTTAGGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 5, 3: 9, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032141416_1032141420 16 Left 1032141416 7:129334414-129334436 CCAGCCTTCCTAACTCCTAGTTA 0: 1
1: 0
2: 5
3: 9
4: 170
Right 1032141420 7:129334453-129334475 TTGTTAGACATGCAGATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032141416 Original CRISPR TAACTAGGAGTTAGGAAGGC TGG (reversed) Intronic
900742027 1:4336167-4336189 AAGCTAGGAGTCAGGGAGGCTGG + Intergenic
902987085 1:20161510-20161532 TGAGGAGGAGTTAGGAGGGCCGG - Intronic
903763376 1:25715351-25715373 GGACTAGGAGTTGGGAAGGAGGG + Intronic
906178589 1:43798398-43798420 TAAGTAGGACTCAGGAAGGAGGG - Intronic
910506803 1:87958817-87958839 AGACTTGGAGTTAGGAAGTCTGG + Intergenic
911507370 1:98769938-98769960 TGAGTAGGAGTTTGAAAGGCAGG - Intergenic
911774531 1:101791510-101791532 TTGCTAGGAGTTAGGAGGGAGGG + Intergenic
911788961 1:101986438-101986460 AAATTAGGAGTTAGAAAAGCAGG - Intronic
912245434 1:107957245-107957267 TAATTATGAGTTGGGATGGCTGG - Intronic
912458554 1:109816259-109816281 CAGCTTGGAGTGAGGAAGGCAGG - Intergenic
914263643 1:146019833-146019855 TAGTTAGGTTTTAGGAAGGCTGG - Intronic
914695000 1:150069242-150069264 GACCTAGGACATAGGAAGGCTGG - Intronic
918152911 1:181814062-181814084 GAACTAGGAGTTTGGAAAGGGGG - Intergenic
919277732 1:195443276-195443298 TAAATATGATGTAGGAAGGCTGG - Intergenic
919483420 1:198117430-198117452 TATCTATGATTTAGGAAGGAAGG - Intergenic
919823090 1:201485040-201485062 GGACTGGGAGTTAGGAAGCCAGG + Intronic
921998334 1:221446608-221446630 TAAATAGGAGGAAGGAAGGAAGG + Intergenic
1063306330 10:4904650-4904672 TAAATAGTAGTGATGAAGGCAGG + Intergenic
1068891858 10:62156247-62156269 TGACTAGGAGTTAGGAAACTAGG - Intergenic
1073757266 10:106593915-106593937 TAACTAGGAGTTTCGGAAGCAGG - Intronic
1074613864 10:115046699-115046721 GAACTAGGAGTCAGGATGTCTGG + Intergenic
1078746876 11:14124318-14124340 TAAGTAGCAGTTAGGAAGGCAGG - Intronic
1081723259 11:45305376-45305398 TAACTAGCAGTGAGAAACGCTGG + Intergenic
1085205485 11:74729692-74729714 AGACTAGGAGTTGGGAACGCAGG + Intronic
1088092892 11:106064209-106064231 CATCTTGGAGTTAGGGAGGCTGG - Intronic
1089891667 11:121887614-121887636 TAACTTGCAGTCAGTAAGGCTGG + Intergenic
1090254475 11:125273634-125273656 TTCCTAGGAGTTAGGAGGCCTGG + Intronic
1091448380 12:557854-557876 AGACTAGGAATCAGGAAGGCTGG - Intronic
1092214166 12:6668912-6668934 TAAGTTGGAGCTAGGGAGGCAGG + Intronic
1092756875 12:11771867-11771889 TAACTTGGAGTCAGGAAGCCTGG + Intronic
1094667163 12:32531772-32531794 TACCTAAGAGTTAGGATTGCTGG + Intronic
1095652663 12:44631066-44631088 TACCTAGGAGTTCTGAAGGTAGG - Intronic
1096370562 12:51065710-51065732 TAACTAGCACTTTGGGAGGCTGG - Intronic
1096605071 12:52759109-52759131 TAACTAGGAGGTGGGGAGCCAGG - Intergenic
1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG + Intronic
1098034959 12:66292530-66292552 TAACTTAGAGTTATGGAGGCTGG + Intergenic
1098196931 12:68012117-68012139 TAACTAGGGCTAAGGGAGGCAGG - Intergenic
1098825983 12:75297858-75297880 TGACTAGGAGTTAGCAAGGCTGG - Intronic
1101168646 12:102064667-102064689 TGAGTAGGAGTTAGCCAGGCAGG - Intergenic
1103541825 12:121671583-121671605 AAAATAGGAATTAGCAAGGCCGG + Intronic
1104223209 12:126806245-126806267 TCACCAGGAGTGAGGAAGGGAGG - Intergenic
1106837039 13:33645551-33645573 TAACTATGAAGTAGGAAGGAGGG + Intergenic
1109100862 13:58181923-58181945 TAACAAGGAGTTAGGAGGTAGGG - Intergenic
1109722931 13:66299505-66299527 TAACTAGGAAGTTGGAAGACTGG + Intergenic
1110495583 13:76163857-76163879 TACATAGGAGCTAGGAAGTCAGG + Intergenic
1111540384 13:89660660-89660682 AAACAAGGAGTCAGAAAGGCTGG + Intergenic
1112749318 13:102566072-102566094 TTACTAGGAGCTAGGATGGAAGG + Intergenic
1113055662 13:106264374-106264396 TATCTAGGAATTAGCATGGCAGG + Intergenic
1114298891 14:21356111-21356133 AAAGTAGGATTTGGGAAGGCTGG + Intronic
1115302837 14:31903571-31903593 GAAGTAGGAGTTAGGGAGGAAGG - Intergenic
1118082685 14:62379810-62379832 TTACCAGGAGTTAGGAAAGAGGG + Intergenic
1119137871 14:72237598-72237620 GGACTAGGAGTTAGGAAACCAGG - Intronic
1119468858 14:74881386-74881408 TGACTCGGGGTTAGGAAGACAGG + Intergenic
1122201316 14:100124309-100124331 GGACTAGGAGTCAGGAAAGCCGG + Intronic
1127628164 15:60800723-60800745 TAAATAGGAGTTTGGGGGGCTGG - Intronic
1128288225 15:66456430-66456452 TCACCAGGAGGTCGGAAGGCAGG + Intronic
1128680707 15:69649303-69649325 GAGCTGGGAGGTAGGAAGGCAGG + Intergenic
1128837326 15:70820554-70820576 TATCTAGGAGTTGGAATGGCTGG - Intergenic
1130950796 15:88585877-88585899 TTGCCAGGAGTTAGGAAGGGAGG + Intergenic
1131048185 15:89329305-89329327 TGGCTAGGATTTGGGAAGGCAGG - Intronic
1131898178 15:97056862-97056884 AAACTAGCAAGTAGGAAGGCAGG + Intergenic
1133429294 16:5722752-5722774 TAACTAGAAGTAAGCCAGGCAGG - Intergenic
1143645544 17:8227770-8227792 CAACTAGGAGTCAGGAGGCCTGG + Intronic
1143967387 17:10766264-10766286 TAACTAGCAGTGAGGAGGGAGGG + Intergenic
1144081403 17:11767282-11767304 TATCTAGGAGTTAAGAATGGGGG + Intronic
1144323041 17:14149624-14149646 TGGCTAGGAGTGTGGAAGGCAGG + Intronic
1144668040 17:17115347-17115369 GGGCTAGGAGTTAGGAAGCCTGG + Intronic
1145932279 17:28694534-28694556 GAACTATGACTTAGGAGGGCTGG + Intronic
1146110899 17:30088328-30088350 TAAAAAGGACTTGGGAAGGCTGG - Intronic
1146298830 17:31672412-31672434 AAACTAGGAGCTTGGAAGGGTGG - Intergenic
1149794446 17:59506346-59506368 TGAGAAGGAGTTAGGAATGCAGG + Intergenic
1151263745 17:72937550-72937572 TACAGAGGAGTTAGGAAAGCTGG + Intronic
1151432994 17:74077311-74077333 AATCTAGGAGTTGGGAAGCCTGG + Intergenic
1151547660 17:74803019-74803041 TTCCTAGGAGTTAAGAATGCTGG - Intronic
1155818250 18:30343516-30343538 TATCTAGGAGTGAGAAAGTCAGG + Intergenic
1158209697 18:55034522-55034544 TTGGTAGGAGTTAGGAATGCAGG - Intergenic
1161448067 19:4328970-4328992 AAACTAGGAGCCTGGAAGGCCGG - Intronic
1162677012 19:12306704-12306726 TGACTAGGAGTTACACAGGCAGG - Intergenic
1164001870 19:21107772-21107794 ATACTAGCATTTAGGAAGGCTGG - Intronic
1164473969 19:28559107-28559129 TATCCAGGAGTTAGGAGGGAGGG - Intergenic
1164486861 19:28665579-28665601 CAACTAGCAGCTAGGAAGGGAGG + Intergenic
1165847945 19:38831029-38831051 TTGCCAGGAGCTAGGAAGGCTGG + Intronic
1167881927 19:52466271-52466293 TAACTAGGAGCCAGCAAGTCTGG + Intronic
1168402147 19:56091591-56091613 AAACTGGGAGTGGGGAAGGCAGG + Intronic
926837209 2:17036252-17036274 TAACTAGAAGGAAGGAAGGAAGG + Intergenic
928846456 2:35679329-35679351 TAACTAGGAGATAGGATGTGAGG + Intergenic
931212522 2:60211372-60211394 AAACTAGGAGTGAGGAAGCCTGG - Intergenic
932399887 2:71473060-71473082 CAGCTAGGATTTAGGAAGGTGGG + Intronic
934714184 2:96533781-96533803 GAACGAGGAGTTAGGCAAGCAGG + Intergenic
934761439 2:96859074-96859096 TAACTGGGAATTGAGAAGGCTGG - Intergenic
937178105 2:119962735-119962757 TAACCAAGAGGTAAGAAGGCAGG + Exonic
939598893 2:144163881-144163903 TAGCTAGTAGTTAGCAAAGCAGG - Intronic
939993836 2:148901766-148901788 GAGCAAGGAGCTAGGAAGGCTGG - Intronic
941433951 2:165445155-165445177 TTACTAGGAGTTAGTATAGCTGG + Intergenic
941498760 2:166241888-166241910 CAACTAAGAGTCAAGAAGGCAGG + Intronic
941779379 2:169427454-169427476 CCACTAGGAGTTAGGAAGGGAGG + Intergenic
944215005 2:197246152-197246174 AATCTAGGAGTTAGGTAGGCAGG - Intronic
944538168 2:200731428-200731450 TGACTAGGAGCTAGGAAGAAAGG + Intergenic
946446371 2:219743005-219743027 CACCTGGGAGTTAGGAAGTCCGG + Intergenic
948075639 2:235163359-235163381 TAACAAGGGGAGAGGAAGGCAGG + Intergenic
948168915 2:235885231-235885253 CTACTATGAGTGAGGAAGGCAGG - Intronic
1171370898 20:24661409-24661431 GAAGGAGGAGTTAGGAAGGAGGG + Intronic
1174275322 20:49399388-49399410 TAGCTGGGAGATAGGAAGCCTGG + Intronic
1174909042 20:54586673-54586695 TGACTAGGTGTTAGGATGGGAGG + Intronic
1177725613 21:24963213-24963235 TGATTAGGAGACAGGAAGGCAGG - Intergenic
1179264668 21:39792673-39792695 TAACAGGGAGTTGGGAATGCTGG + Intronic
1180641735 22:17304413-17304435 TAAGTAGGATGTAGGCAGGCAGG - Intergenic
1182378124 22:29863543-29863565 TTGCCAGGAGTTAGCAAGGCAGG - Intergenic
950222459 3:11206725-11206747 TAACAATGAGTTTGGAAGTCAGG - Intronic
952013356 3:28928707-28928729 TAACTAGGTGTTAAGTAGACTGG + Intergenic
952988942 3:38814159-38814181 TATCCAGGAGTTGGAAAGGCAGG + Intergenic
955653779 3:61222299-61222321 TAATTAAGACTTTGGAAGGCAGG - Intronic
959190923 3:103109966-103109988 TAACTAGAAATCAGGAAGTCCGG - Intergenic
959502615 3:107123967-107123989 TAAGTAGAAGGTAGGAAGGTGGG + Intergenic
959561984 3:107792948-107792970 TACCTGGGAGTTAGGAAATCTGG + Intronic
960466163 3:117998322-117998344 TGACTAGTAGTTAGGAAAGCTGG + Intergenic
960749477 3:120931258-120931280 TAACTAGAAGGTAGGAAGAGTGG + Intronic
966827986 3:183981285-183981307 AAACTGGGAGTCAGGATGGCTGG - Intronic
967468731 3:189838175-189838197 TAAATAGGAGAGAGGAAGGGAGG - Intronic
967550496 3:190789177-190789199 TCACCAGGAGTTAGGAGGGAAGG - Intergenic
968360908 3:198146046-198146068 TTGCAAGGAGTTAGGAATGCTGG - Intergenic
972946270 4:44260014-44260036 CATTTAGGTGTTAGGAAGGCAGG + Intronic
973330016 4:48903584-48903606 CATCTAAGAGTTAGTAAGGCTGG + Intronic
973638063 4:52877944-52877966 TTGCGAGGAGTTAGGGAGGCTGG - Intronic
975091775 4:70412108-70412130 TAACCAGGAGTTAGGACCACAGG - Intergenic
975289829 4:72664715-72664737 TCACTTGGTGTAAGGAAGGCAGG - Intergenic
977582839 4:98744271-98744293 CCAGTAGGAATTAGGAAGGCAGG - Intergenic
982927212 4:161353406-161353428 TAACCAGTAGATAGGAAGGTTGG - Intergenic
983700716 4:170590492-170590514 TCACTAGGAGTCAGGAAAGCTGG + Intergenic
987617855 5:20299955-20299977 TAAATAGGATTTAGCAAGACAGG + Intronic
992081097 5:73234601-73234623 TAACGAGGAGAAAGGAAGGGTGG + Intergenic
993085694 5:83361004-83361026 TAAATAGGAATTAGGAATGTGGG + Intergenic
995919033 5:117288468-117288490 AAAATAGAAGTTAGGAAGGCAGG - Intergenic
997568703 5:134909035-134909057 TGACTAGAAGTCAGGAAAGCAGG - Intronic
997661558 5:135593061-135593083 TAAACAGGAGTCAGGAAGCCGGG - Intergenic
999072435 5:148760146-148760168 TAACTCTGAGTAAGGTAGGCAGG + Intergenic
999536294 5:152521215-152521237 TCACTAGGACTTAAGAAGGTGGG + Intergenic
999658183 5:153830897-153830919 TAACTTGGACTTAGAGAGGCTGG - Intergenic
1003191774 6:3880913-3880935 GAACTGTGAGTTAGGAAGTCCGG - Intergenic
1003692272 6:8366481-8366503 TAAGTAGGAGCTAGGGAGGCTGG + Intergenic
1004373213 6:15070514-15070536 TCACTAGGAGAGAGGAAGGAGGG - Intergenic
1007782820 6:44264092-44264114 TAAATAGGAGTAGGGGAGGCAGG - Intronic
1008454887 6:51697958-51697980 TACCTAGGAGATAGGAAGTAAGG + Intronic
1008501993 6:52192224-52192246 AAACTTGGAGTTAGCAAGGAAGG - Intergenic
1010571768 6:77482066-77482088 TAACTATGTGGAAGGAAGGCTGG - Intergenic
1012396274 6:98801079-98801101 GGACTAGGAGACAGGAAGGCAGG + Intergenic
1012601724 6:101106555-101106577 ATACTAGGAGTGAGGAAGGTGGG + Intergenic
1016017653 6:139202860-139202882 TTACTAGAAGCTGGGAAGGCAGG - Intergenic
1017995408 6:159527778-159527800 TAACAAGGACAAAGGAAGGCAGG - Intergenic
1018207945 6:161453205-161453227 TGAGTAGCAGTTAGGAGGGCGGG + Intronic
1018545572 6:164932991-164933013 TGGCTAGGAGTTGGCAAGGCTGG - Intergenic
1019259102 7:70608-70630 TTGCAAGGAGTTAGGAATGCTGG + Intergenic
1020820654 7:12963493-12963515 TATCTGGGAGTTGGGGAGGCAGG + Intergenic
1022325346 7:29325880-29325902 GAATTAGGAGTTAGGAAAACTGG + Intronic
1026330490 7:69348063-69348085 TAAATAAAAGTTAAGAAGGCCGG + Intergenic
1030349432 7:108467634-108467656 TGACTAGGAAATAGGAAGGAGGG - Intergenic
1031031721 7:116742803-116742825 TAAGCTGCAGTTAGGAAGGCAGG + Intronic
1031641404 7:124169086-124169108 TATGTAGGAGTCAGGAAGGGTGG - Intergenic
1032141416 7:129334414-129334436 TAACTAGGAGTTAGGAAGGCTGG - Intronic
1035812920 8:2507448-2507470 TAAGTAGGAGTTTGTCAGGCAGG - Intergenic
1039584083 8:38691059-38691081 TACTTAGAAATTAGGAAGGCTGG - Intergenic
1039802756 8:40974290-40974312 TAACTAAGCCTCAGGAAGGCAGG - Intergenic
1039841547 8:41296937-41296959 TAACTAGAAGTTAGGAGATCTGG - Intronic
1040348317 8:46533889-46533911 TAACTAGGAGCCAGCAAGTCTGG - Intergenic
1042000857 8:64122511-64122533 TAACTAGGAGTGATGAAGAGTGG + Intergenic
1043341452 8:79244765-79244787 AAAATAGGAGTTGGTAAGGCTGG + Intergenic
1043413279 8:80022099-80022121 TTACTAGGAGTTAGGAAGGAGGG - Intronic
1045742541 8:105378243-105378265 GAACTAAGAATTAGGGAGGCGGG + Intronic
1046679601 8:117153941-117153963 TAATTATGAGTTGAGAAGGCTGG - Intronic
1056307429 9:85303756-85303778 TCACTAGGAGTTAGGAGGGCCGG + Intergenic
1057290229 9:93801671-93801693 TAACTATGAGTCTGGAGGGCAGG - Intergenic
1059561237 9:115336533-115336555 TAACTAGGAGTCAGGAAGCCTGG + Intronic
1060561127 9:124544579-124544601 TAAGTAGGATTTAGGCAGCCAGG + Intronic
1061265613 9:129503198-129503220 AAACTTGGAGGCAGGAAGGCTGG + Intergenic
1186442221 X:9596321-9596343 TAGCTGGGATTTTGGAAGGCTGG - Intronic
1187461990 X:19495443-19495465 TAACTAGGAGGAAGGAGGGGAGG + Intronic
1190452289 X:50594127-50594149 TGAGTAGCAGTTTGGAAGGCAGG - Exonic
1191848890 X:65570992-65571014 AAACCAGCATTTAGGAAGGCTGG - Intergenic
1193149244 X:78107399-78107421 TTACCAGGAGTCAGGAAGGGGGG - Intronic
1196020868 X:110989746-110989768 CAACTAGGAGGCAGGAAAGCTGG - Intronic
1196780729 X:119381773-119381795 TAATACGGAGTTAGGAATGCAGG - Intergenic
1196793217 X:119482626-119482648 CAACTAGGAGAGAGGAGGGCAGG + Intergenic
1197857893 X:130936826-130936848 TAACTAGAAGTTGGGAAGAGTGG + Intergenic
1197967653 X:132082170-132082192 TAACTAGGAGGGAGGAAGATGGG - Intronic
1201298091 Y:12482418-12482440 TAAATGGAAGTTAGGAAGGAAGG - Intergenic