ID: 1032143038

View in Genome Browser
Species Human (GRCh38)
Location 7:129351448-129351470
Sequence TTCTCTCTTGAGTGTAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032143038_1032143040 -1 Left 1032143038 7:129351448-129351470 CCCACTCTACACTCAAGAGAGAA 0: 1
1: 0
2: 3
3: 23
4: 211
Right 1032143040 7:129351470-129351492 ATGAAAAGTGAAAAAGACAAAGG 0: 1
1: 1
2: 9
3: 144
4: 1447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032143038 Original CRISPR TTCTCTCTTGAGTGTAGAGT GGG (reversed) Intronic
903548312 1:24140960-24140982 ACCCCTCTTGTGTGTAGAGTTGG - Intronic
905177229 1:36144918-36144940 GTCTCACCTGAGTGTAGAGCTGG - Intronic
905677646 1:39839486-39839508 TTCGCTGTTGAGTGTAGGGAAGG - Intergenic
906778703 1:48553034-48553056 TTCCCTCTTGAGTGAGAAGTGGG - Intronic
907203864 1:52751920-52751942 TTCTGTGTTGAGAGTACAGTAGG - Intronic
908338078 1:63147806-63147828 TTCTCTTTTGAGTGGGGGGTGGG + Intergenic
908669783 1:66533566-66533588 TTCTCTCTTGAATGAAGGATGGG + Intronic
909130398 1:71728598-71728620 TTCTCTTTTGATTTTCGAGTAGG + Intronic
911185352 1:94898391-94898413 TTCTCTCTTAAATCCAGAGTAGG - Intronic
911983537 1:104595154-104595176 TTCTCTTTTGAGTATAGGGAGGG - Intergenic
912463090 1:109850353-109850375 TTCTCTGTATAGTGTGGAGTTGG + Intergenic
914349546 1:146828413-146828435 TTCTCTCTTTTGTTTAGACTGGG - Intergenic
914952386 1:152127891-152127913 TCCTCTCTGGGGTGGAGAGTGGG + Intergenic
916619300 1:166478468-166478490 TTGTCTCTTGTGTGTAGATAAGG - Intergenic
918345673 1:183605124-183605146 TTCTCTCTTTACTTTAGAGAAGG + Intergenic
918891797 1:190282153-190282175 TTCTCTATTCACTTTAGAGTGGG + Intronic
919888977 1:201956113-201956135 TTCTTTCTTGAGGGTAGAGGGGG + Intronic
921848700 1:219910729-219910751 TTCTCATTAGAGTGCAGAGTAGG + Intronic
921854096 1:219962742-219962764 TTCTCTCCTGAGCGTGAAGTTGG + Intergenic
923944341 1:238865490-238865512 TTCTTTCTTGAATTTATAGTGGG + Intergenic
924406571 1:243754183-243754205 GTTTCCCTTGAGTGTATAGTAGG - Intronic
1062810398 10:459233-459255 TTGTCTCCTGAGTGCACAGTGGG - Intronic
1063306057 10:4901832-4901854 TTCTTTCTTGTGTGTTGAGATGG + Intergenic
1064932769 10:20645151-20645173 TTCCCCCTTGAATGGAGAGTTGG - Intergenic
1065674658 10:28161757-28161779 TTTTCTATTGAGTGAAAAGTTGG - Intronic
1067382569 10:45788502-45788524 GTTTCTGTTGAGGGTAGAGTAGG + Intronic
1067890273 10:50129052-50129074 GTTTCTATTGAGGGTAGAGTAGG + Intronic
1068573860 10:58661313-58661335 TTCTCTCTGGAGTTTAGAAATGG + Intronic
1068732630 10:60376071-60376093 TTCTCTGTGGAGTGTGAAGTCGG - Intronic
1070517072 10:77218137-77218159 TTCTCTCTTGACAGTTGAGAGGG + Intronic
1072816755 10:98517180-98517202 TTCTCTGTTGGGTGTGGGGTGGG + Intronic
1074905832 10:117862629-117862651 TTCTCTCCTAAGTGCAGAGATGG + Intergenic
1076314724 10:129532300-129532322 TGCTCTCTGGGGTGCAGAGTTGG + Intronic
1077332533 11:1989772-1989794 TTCTCTCTAGAGGGAAGAGGAGG + Intergenic
1077847651 11:6043047-6043069 ATCTCTCTTGACTGTGGAGAAGG - Intergenic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1078598143 11:12706890-12706912 TTTTCTCTTCAGTGTAAAATGGG - Intronic
1079027911 11:16963338-16963360 TTCTTTTTTGAGGGTGGAGTAGG + Intronic
1079212949 11:18479696-18479718 TCTTCTCTTGGGAGTAGAGTGGG + Intronic
1079523690 11:21359082-21359104 TTCCCTTTTGAGTGTAATGTTGG + Intronic
1081383690 11:42446121-42446143 TTCTCTCTTGCGGGTAGAGTGGG - Intergenic
1081619248 11:44609292-44609314 TTCTCTCTAGAGAGTGGAGGTGG + Intronic
1082758135 11:57098404-57098426 TTCTATTTAGAGTGCAGAGTTGG - Intergenic
1084804308 11:71568264-71568286 TCCTCTCTCCAGTGGAGAGTGGG + Intronic
1085823438 11:79817713-79817735 TCCTCACATGAGTGTAGAGAGGG + Intergenic
1087365864 11:97217885-97217907 TTCTCCCTTGAGGGAAGAGGAGG + Intergenic
1087678897 11:101195734-101195756 TTCTTTCTGGACTGTATAGTAGG - Intergenic
1088378425 11:109167264-109167286 TTCTCTCTTGCCTGAAAAGTGGG - Intergenic
1088443299 11:109896016-109896038 TTCTTTCATAAGTGTATAGTAGG + Intergenic
1089936875 11:122373636-122373658 ATTTCTCTTGAGTGTATACTAGG + Intergenic
1090661948 11:128888829-128888851 TTCTCTCCTGAGGGAAGAGGAGG + Intergenic
1202815514 11_KI270721v1_random:44948-44970 TTCTCTCTAGAGGGAAGAGGAGG + Intergenic
1091551315 12:1537106-1537128 ATCTCACTTGGGTGTATAGTAGG + Intronic
1093840410 12:23892628-23892650 TTCTGTCTTGAGTAAATAGTTGG - Intronic
1094038287 12:26094424-26094446 CTCTTCCCTGAGTGTAGAGTTGG - Intergenic
1094233775 12:28139375-28139397 TTCCCTCTTGAGGGAAGGGTTGG - Intronic
1094272275 12:28630045-28630067 TTTTCTCTTGGGACTAGAGTAGG - Intergenic
1096246381 12:49990338-49990360 TTCTCTTTTTATTGTAGATTTGG - Exonic
1096887960 12:54736445-54736467 TTTTCTCTTGAGGGTAGGGGTGG - Intergenic
1098047929 12:66421200-66421222 ATATCACTTCAGTGTAGAGTGGG + Intronic
1098898205 12:76085636-76085658 TTCTCTCACAAGTGTACAGTGGG + Intergenic
1099992996 12:89746178-89746200 TTGTCTCTTGTGGGTGGAGTGGG - Intergenic
1100421617 12:94440071-94440093 TTCTCTGTTCAGTGTAATGTTGG - Intronic
1101114998 12:101523325-101523347 TTCTTTCTTGACCCTAGAGTAGG - Intergenic
1106273119 13:28173757-28173779 TTCTCTTTAGAGTTTAGGGTAGG - Intronic
1111213702 13:85115150-85115172 TCCTCTCTGGAATGCAGAGTAGG - Intergenic
1113075847 13:106467448-106467470 TTCTCCTTTGAGGGAAGAGTCGG - Intergenic
1113510955 13:110854551-110854573 TTCCATCTTGAGTGTAAAGGTGG - Intergenic
1114865819 14:26595608-26595630 TTCTCTCTTGAGGGTGGAGAGGG - Intronic
1115475461 14:33809067-33809089 TTCTTTCTTGACTTTTGAGTGGG - Intergenic
1117155059 14:52930968-52930990 TTCTCTTTCGATTTTAGAGTTGG + Intronic
1117804368 14:59475587-59475609 TTCTCTCAAGAGTGTACAGTGGG - Intronic
1119961908 14:78868320-78868342 TTGTCTTTTGAGTGCAGAGAGGG - Intronic
1120991356 14:90380262-90380284 TTCTCACGTGAGTGAAGAGCTGG - Intergenic
1121434429 14:93909816-93909838 TTCTTTCATGGGTGTTGAGTTGG + Intergenic
1121916355 14:97839765-97839787 TCCTCTCTGGAGGTTAGAGTAGG - Intergenic
1125215661 15:37270971-37270993 TTCTATCTTGAGTGGATAGTTGG + Intergenic
1126862625 15:52901905-52901927 TTATATCTTGATTGTAGGGTTGG - Intergenic
1128558651 15:68649868-68649890 CTCTCTCTTGAGTGTATAGTGGG - Intronic
1128996681 15:72302232-72302254 TTCTCTCCTGAATATATAGTAGG + Intronic
1130808407 15:87351423-87351445 TTCCCTCTTGTGTGTAGTGTTGG - Intergenic
1131623041 15:94087666-94087688 TTTTCTCTTCAGTGTTGCGTAGG - Intergenic
1135171554 16:20188548-20188570 TTCAATCATGAGTGAAGAGTTGG + Intergenic
1139120967 16:64016402-64016424 TTATTTCTTGAGTGTATACTGGG - Intergenic
1139524426 16:67505371-67505393 GTCTTTCATGAGTGTACAGTGGG + Intergenic
1140785682 16:78339817-78339839 TTCTCTCTTGGGAGTACAATGGG + Intronic
1141109179 16:81257969-81257991 TTCTCTCTTGAGATTACACTGGG - Intronic
1141216940 16:82033626-82033648 TTCTCCCTTGGGTCTTGAGTTGG + Intergenic
1144073150 17:11692696-11692718 TTCTTCCATGAGTGTACAGTGGG + Intronic
1147847701 17:43416657-43416679 TTCTGACTTGGGTGTTGAGTGGG - Intergenic
1147985374 17:44304088-44304110 TTCTCTCTTGAGCATCAAGTTGG + Intergenic
1149689828 17:58566122-58566144 TTCTATTTTGAGTGTTGTGTGGG - Intronic
1150583943 17:66500593-66500615 TTATCTCTTGAGTATCCAGTGGG + Intronic
1151338642 17:73455813-73455835 GTCTCCCTTGAGTGTGGAGGAGG - Intronic
1153399123 18:4663085-4663107 TTATCTCATGAGTGTAGGGCTGG + Intergenic
1154076216 18:11204412-11204434 AGCTCTCTTGAATTTAGAGTTGG + Intergenic
1155932052 18:31718685-31718707 TTCTCTCAGGAGTGGAGAGGAGG - Intergenic
1156837717 18:41575174-41575196 TTCTCCTTTGAGTGTCGTGTTGG - Intergenic
1157113951 18:44845790-44845812 TTCCCTCTTGAGTGCAGGGTAGG - Intronic
1157417401 18:47516087-47516109 CTGTCTCTTGATTGTGGAGTTGG + Intergenic
1158144562 18:54297385-54297407 TTCTGTCTTGAGTGTAGGCCTGG + Exonic
1160554377 18:79716545-79716567 TTCTCTCCTGAGCGTGGAGCCGG + Intronic
1164104607 19:22097405-22097427 TTTTCTCTTGAGTGTAAAAAAGG + Intergenic
1166972671 19:46580213-46580235 GTCTCTCTTGAGGGTGGATTGGG - Intronic
1167361152 19:49031237-49031259 TCCTGGCTTGAGGGTAGAGTGGG + Intronic
1167362498 19:49037560-49037582 TCCTGGCTTGAGGGTAGAGTGGG - Intergenic
1167363630 19:49043624-49043646 TCCTGGCTTGAGGGTAGAGTGGG + Intergenic
1167364868 19:49049302-49049324 TCCTGGCTTGAGGGTAGAGTGGG - Intergenic
1168568944 19:57448256-57448278 TTCTTTCTTCAGTGTACATTTGG + Intronic
926868166 2:17382781-17382803 ATCTCTCTTGAATATAGAGAAGG - Intergenic
927742488 2:25584199-25584221 TTCTCTGAAGAGTGTACAGTGGG + Intronic
929438835 2:41949573-41949595 TTTTCTCCTGTGTGTGGAGTGGG - Intronic
929799518 2:45087666-45087688 TTCTCTCTTGACTGTGGTGATGG - Intergenic
931257297 2:60584751-60584773 TTCTCTTTTGAGGGGAGAGAAGG - Intergenic
931593387 2:63911508-63911530 TTCTCTCATGATTGAACAGTGGG + Intronic
931836314 2:66101761-66101783 TTCTCTCTTTAGTCTAGTATAGG - Intergenic
932089424 2:68791766-68791788 TTCTCCCTTGACTGGAGAGATGG + Intronic
932673474 2:73757908-73757930 TTATCTCTTTAGTATAGTGTGGG - Intergenic
933645036 2:84805224-84805246 TTCTGTCTTGGAGGTAGAGTTGG - Intronic
934894702 2:98105454-98105476 CTCTCTCTTGATTGTAGTGGTGG - Intronic
935568847 2:104637637-104637659 ATCTCTCTGGAGTCTCGAGTTGG - Intergenic
936155865 2:110047185-110047207 TTCTCTCCTGAGTGTTGTGTGGG + Intergenic
936188823 2:110324243-110324265 TTCTCTCCTGAGTGTTGTGTGGG - Intergenic
937087551 2:119181427-119181449 TTCTCTCTTGAGCCTGGACTTGG - Intergenic
937504555 2:122522436-122522458 TTCTCTCCAGAGGGTAGAATGGG + Intergenic
938637830 2:133248693-133248715 AATTCTCTTCAGTGTAGAGTTGG + Intronic
943023267 2:182600013-182600035 TTTTCTCCTGGGAGTAGAGTAGG - Intergenic
943658134 2:190530546-190530568 TTCTCTCTAGAGAGAACAGTGGG - Intronic
944816144 2:203377733-203377755 TTCTCTACTGTCTGTAGAGTTGG - Intronic
945499552 2:210554367-210554389 TTCTCTCTAGACTTTAGAGTAGG + Intronic
1169050010 20:2567936-2567958 TTCTCTCTATAGTTTAGATTGGG - Intronic
1169472530 20:5900345-5900367 ATTTCTCTTGAGTGTATACTTGG - Intergenic
1170475663 20:16711882-16711904 TTCTCTCCTGAGTTCAGTGTCGG - Intergenic
1170501934 20:16982916-16982938 TTCTCTCCTGAGTGTGAAGCTGG - Intergenic
1171031356 20:21679725-21679747 TACTTTCTTGAGAGTGGAGTGGG - Intergenic
1171470299 20:25364940-25364962 TTCCCTACGGAGTGTAGAGTTGG + Intronic
1174851338 20:53998108-53998130 TTCTCTCAGTAGTGGAGAGTGGG + Intronic
1175136498 20:56828332-56828354 TTCTTTCTTCAGTGTAAAATGGG + Intergenic
1179076949 21:38131169-38131191 TTCTCTCTGAAGTGTATAGTCGG - Intronic
1179161349 21:38902143-38902165 ATCTCCCCTGAGTGGAGAGTTGG - Intergenic
1180289041 22:10780205-10780227 TTTTCTCAGAAGTGTAGAGTTGG - Intergenic
1181595265 22:23910322-23910344 TTGACTCTTGGGTGAAGAGTTGG - Intergenic
1181630390 22:24148097-24148119 TTCCCTCTTGAGAGAAGACTTGG + Intronic
1184205581 22:43000328-43000350 TTCTCTCCTTGGGGTAGAGTTGG - Intronic
1185281009 22:49969882-49969904 TTCCCTCCTGAGTGAAAAGTGGG - Intergenic
950406614 3:12808997-12809019 TTCTCTCTGCAGTGGAGAGTAGG + Intronic
950537621 3:13589182-13589204 TTCTCTCTTTTGCATAGAGTTGG + Intronic
953695224 3:45153014-45153036 TTCTCTCCTGAGTGAACAGATGG + Intergenic
953834717 3:46332594-46332616 TTATCTCTTGAGGGCAGAGGTGG + Intergenic
956188379 3:66584094-66584116 TTCTCTGTTGATTGAAGTGTGGG + Intergenic
957751235 3:84419057-84419079 TTGCCTCTGGTGTGTAGAGTAGG + Intergenic
957856022 3:85879919-85879941 TTGTCTCTTGATTGTAGTGATGG - Intronic
959086117 3:101852238-101852260 TTCTGTTTTGAGTATAGAGTTGG + Intronic
962121607 3:132566265-132566287 TTCTCTCTTTGGTTTAGGGTGGG - Intronic
962272689 3:133989658-133989680 GGCTGACTTGAGTGTAGAGTTGG - Intronic
962581085 3:136798578-136798600 TGCTCTCTTTAGTGCAGAGGGGG + Intergenic
963285635 3:143431941-143431963 TTATCTCTTGAGTAAAGACTGGG - Intronic
963327754 3:143881109-143881131 TCCTCCCTTCAGTGTAGTGTGGG - Intergenic
964790137 3:160446217-160446239 CTCTCCCTTGAGTGTGGACTAGG + Intronic
965772591 3:172196505-172196527 TTTTTCCTTGAGTTTAGAGTTGG + Intronic
965921244 3:173917012-173917034 TTCTCACTTGATTGAATAGTAGG - Intronic
968647003 4:1746195-1746217 TTCTCCCATCAGTGAAGAGTGGG + Intergenic
970580616 4:17471138-17471160 TTCTGTCTTGAGTGGAGACACGG - Intronic
970897851 4:21124218-21124240 TTCTCTCATAAATGTATAGTGGG - Intronic
971805618 4:31355058-31355080 TTCTCTCTTTGGTGTACAGGTGG - Intergenic
973015212 4:45129311-45129333 TTCTCTGTTGATTGTTGTGTTGG + Intergenic
973033526 4:45375025-45375047 TTCTCTTTTCTGTGTAGAGCTGG + Intergenic
974670983 4:65029819-65029841 TTCTCTCCTGAGTGTGGTGCAGG - Intergenic
974743331 4:66036969-66036991 TTTTTTCTTGATTATAGAGTTGG + Intergenic
975683661 4:76898677-76898699 TTCTCTTTTCAGTATAGACTTGG - Intergenic
978288261 4:107105033-107105055 ATCTCTCATGATGGTAGAGTAGG - Intronic
983527391 4:168773069-168773091 TTCTCTCAAGAGTTTAGAGTAGG + Intronic
983964427 4:173792324-173792346 ATTTCTCTTGACTGTAGAATGGG + Intergenic
984271227 4:177550740-177550762 TTCTCTTCTGAGTTTAGACTTGG + Intergenic
989518198 5:42368603-42368625 TTTTCTCTAGGGTGTATAGTAGG - Intergenic
992298196 5:75348297-75348319 TTTTTTCTTGAGTGTAGTGGTGG - Intronic
994870363 5:105341141-105341163 TCCACTCTTGAGTGGAGACTTGG + Intergenic
996563970 5:124860362-124860384 TTCTGACTTGAGTTTACAGTGGG + Intergenic
998905754 5:146902984-146903006 TTCTCTCATGAGTGTACAGCAGG + Intronic
1000065905 5:157693191-157693213 TTCTCTTGTGAGTGTAATGTAGG - Intergenic
1005649361 6:27872331-27872353 TTCTCTCATTTGTGTTGAGTAGG - Intergenic
1005881572 6:30066461-30066483 TTCTCTCTGGGGTGATGAGTAGG - Intergenic
1005909890 6:30299928-30299950 TTATCCCTGGAGTGCAGAGTTGG - Intergenic
1005966871 6:30732762-30732784 TTCTCTCTGGAGTGAACAGATGG - Intronic
1007723322 6:43899048-43899070 TTGACACTTGAGTTTAGAGTAGG - Intergenic
1009659211 6:66588227-66588249 TTCTGTATTAAGTGGAGAGTAGG - Intergenic
1009829040 6:68905908-68905930 TTCTCTCTAGAATATAGAGAGGG - Intronic
1011967115 6:93173335-93173357 TTCTCTCTTTAGTTTGGAGGTGG - Intergenic
1012587805 6:100945446-100945468 TAGGCTCTTGTGTGTAGAGTGGG - Intergenic
1013315321 6:108936712-108936734 ATCTCACTAGAGTGTAGAGCAGG + Intronic
1013408470 6:109863372-109863394 TTTTCTGTTGAGTCTATAGTTGG + Intergenic
1014088188 6:117372132-117372154 TTCTCTATTCAGTGTAATGTTGG - Intronic
1015845014 6:137511205-137511227 TTCTCTCTTCAGTTCAGACTGGG - Intergenic
1016542949 6:145187344-145187366 TTCTGTGTTGAGAGTATAGTTGG - Intergenic
1016910250 6:149191938-149191960 ATCTATTTTAAGTGTAGAGTTGG - Intergenic
1017439061 6:154445876-154445898 TTCTCTCTTTAATGTGGAATGGG - Intronic
1020805779 7:12788896-12788918 TTCTATCTTGACTGTAGTGATGG + Intergenic
1022978963 7:35585272-35585294 TTCTCTCTGGTGTGCAGAGCTGG + Intergenic
1023576105 7:41628836-41628858 TTTTCTGTTGGGTGAAGAGTAGG - Intergenic
1023910548 7:44552599-44552621 TTCTCTCTTTTTTGTAGAGATGG - Intergenic
1024787510 7:52925448-52925470 TTCTCTCTTGTGTGTGTGGTGGG + Intergenic
1026629435 7:72025583-72025605 TTCGCTCTTGTCTGTTGAGTTGG - Intronic
1028103193 7:86846579-86846601 TCTTCTCTGGAGGGTAGAGTGGG - Intronic
1029654732 7:101916798-101916820 TTCTCTCGTGAGTGTGCAATCGG + Intronic
1030651079 7:112116768-112116790 TTTTCTCTTTTTTGTAGAGTCGG + Intronic
1030709000 7:112727327-112727349 TTCTCTCTTGGGTGGAAAGTAGG + Intergenic
1032143038 7:129351448-129351470 TTCTCTCTTGAGTGTAGAGTGGG - Intronic
1032850655 7:135792242-135792264 TTCTCTGTTGAGTGCAGGGAGGG - Intergenic
1033836566 7:145320663-145320685 ATCTCTCCTGAGTGTGGAGATGG + Intergenic
1034009452 7:147512959-147512981 TTTTCTGTTTAGTATAGAGTAGG - Intronic
1037720596 8:21440166-21440188 TTCTCTCATGAGTGCAGAGTGGG - Intergenic
1038523913 8:28257119-28257141 TCCTCTCTCGGGTTTAGAGTGGG + Intergenic
1038909074 8:31941433-31941455 TTCCCTCTTCAGTATAAAGTTGG - Intronic
1042644607 8:70972570-70972592 TTCTCTGTTCAGTATAGTGTTGG + Intergenic
1045404658 8:101853773-101853795 TTGTCTCTTGAGAATAGAGGAGG - Intronic
1045670486 8:104546331-104546353 TTGTGTCTTGATTGTAGTGTTGG - Intronic
1048434442 8:134402975-134402997 TACTCTCTTGAGGGCAGACTTGG - Intergenic
1049628786 8:143639792-143639814 TTCTCTCTTAAAGGTAGGGTTGG + Intronic
1050588129 9:7134209-7134231 TTCTATCTTGACTGTGGAGTTGG + Intergenic
1055683221 9:78740854-78740876 TTCTCTCTTGAATTTAGTTTAGG + Intergenic
1055900136 9:81224684-81224706 TTCTCACTTGGCTGTAGAGCTGG - Intergenic
1056999134 9:91491589-91491611 GTCCCTCTTGTGTTTAGAGTAGG - Intergenic
1057142944 9:92738515-92738537 TTCTCTCTTGAGAGTGGGGAGGG - Intronic
1057332215 9:94126120-94126142 TTCACTCATGAGTGTACAGTGGG - Intergenic
1059754356 9:117278531-117278553 TTCTCTCCTGAATGAAGAGGGGG - Intronic
1060252396 9:121996849-121996871 TTCTCCATAGAGTGGAGAGTTGG - Intronic
1061814807 9:133188307-133188329 TTCTTTTTTGGGTGCAGAGTGGG + Intergenic
1197085090 X:122463372-122463394 TGCCCTCTTCAGTGTGGAGTTGG + Intergenic
1197466624 X:126812615-126812637 TTCTCTCCTGAGGGTGCAGTGGG - Intergenic
1197760764 X:130026382-130026404 TACTCTCTTGAGCGTAGAGATGG - Intronic
1199723325 X:150558799-150558821 TGCTCTCCTGAGTGGAGAGGAGG + Intergenic
1201290500 Y:12417627-12417649 TTCTCTCTTTGGTTTAGAGTTGG + Intergenic
1201461859 Y:14234306-14234328 TTTTCACTTGAGTGTCTAGTAGG + Intergenic
1201505193 Y:14691001-14691023 TCCTCTCATCAGTGTTGAGTTGG + Intronic
1201790989 Y:17840281-17840303 TTCTCTGTTTAGTGTAAAGTAGG + Intergenic
1201810565 Y:18065708-18065730 TTCTCTGTTTAGTGTAAAGTAGG - Intergenic
1202352599 Y:24009930-24009952 TTCTCTGTTTAGTGTAAAGTAGG + Intergenic
1202518180 Y:25660185-25660207 TTCTCTGTTTAGTGTAAAGTAGG - Intergenic