ID: 1032148732

View in Genome Browser
Species Human (GRCh38)
Location 7:129408855-129408877
Sequence AGGGGTATAGAGTTTTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032148727_1032148732 3 Left 1032148727 7:129408829-129408851 CCAGGAGAGATGTATCATGGAGT 0: 1
1: 0
2: 1
3: 11
4: 104
Right 1032148732 7:129408855-129408877 AGGGGTATAGAGTTTTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032148732 Original CRISPR AGGGGTATAGAGTTTTAAGA AGG Intronic
No off target data available for this crispr