ID: 1032153688

View in Genome Browser
Species Human (GRCh38)
Location 7:129451379-129451401
Sequence GGCTGTGTGTGGAGGACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 720
Summary {0: 1, 1: 0, 2: 5, 3: 70, 4: 644}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032153681_1032153688 10 Left 1032153681 7:129451346-129451368 CCTTGAGGAAAGGCAGAAAGACA 0: 1
1: 0
2: 5
3: 76
4: 559
Right 1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG 0: 1
1: 0
2: 5
3: 70
4: 644

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032153688 Original CRISPR GGCTGTGTGTGGAGGACAGA GGG Intronic
900093211 1:929561-929583 GGCAGGGTGTGGTGGGCAGAAGG + Intronic
900393961 1:2445546-2445568 GGCTGTGGGTGGGGAACAGCTGG + Intronic
900512058 1:3065475-3065497 GGCCGTGTGTGCAGGACAGGAGG - Intergenic
900555752 1:3279552-3279574 GGCTCTCTGTGGATGACAAAAGG + Intronic
901430247 1:9209716-9209738 GGCTGTGGGCAGAGGACAGCGGG - Intergenic
901810205 1:11763075-11763097 TGGTGTGTGTGGAGGACAGTGGG + Intronic
901926155 1:12567506-12567528 GGGTGTGTGTGGTGCAGAGAGGG - Intergenic
902573057 1:17359240-17359262 GGCAGTGAGTGGGGGACTGATGG - Intronic
902771999 1:18650501-18650523 GGCAGAGGGCGGAGGACAGAGGG + Intronic
903128410 1:21262897-21262919 GGCCGGGTGTGGGGGACAGTGGG + Intronic
903680720 1:25094978-25095000 GTCTGTGTGTTGAGGGCAGGTGG - Intergenic
904081293 1:27873906-27873928 GGGTGAGTGCGGAGGACAGATGG + Intronic
904472786 1:30746295-30746317 GGCTGGGGGTGGAGGACTGTGGG - Intronic
904687840 1:32273788-32273810 GGCTGTGTGAGGGGAACAGCGGG + Intronic
905434178 1:37945815-37945837 TGCTGTGTGAGGGGGACAGCCGG - Exonic
905918282 1:41700832-41700854 GGCTGTGTTTTGAGGCCAGGAGG - Intronic
906812251 1:48839823-48839845 CCCAGTGTGTGGTGGACAGAGGG + Intronic
906892910 1:49738049-49738071 GTCAGTGTGTGCAGGACAGTGGG + Intronic
906896397 1:49778121-49778143 TGCTGTGAGTGGAGGATGGATGG - Intronic
907247928 1:53120017-53120039 GGCTCTGAGTGGTGGCCAGATGG - Intronic
907326021 1:53638957-53638979 GGCAGGGAGTGGAGGGCAGAAGG + Intronic
907631228 1:56084214-56084236 GGCTGTGTCTGGAGTTCAGGGGG + Intergenic
907872613 1:58456543-58456565 GGCTGAGTGAGGACGGCAGAAGG + Intronic
908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG + Intergenic
908172645 1:61522583-61522605 GCCTGCATATGGAGGACAGAAGG + Intergenic
908474068 1:64471076-64471098 GGGTCTGTGCAGAGGACAGAGGG - Intronic
908690981 1:66780259-66780281 GACAGTGTGTGCAGGACAGTGGG + Intergenic
910135472 1:83963371-83963393 GGCTGTGTGTAGAGGAAGGATGG - Intronic
910767740 1:90799515-90799537 GGCTGTGTTCCGAGCACAGATGG - Intergenic
910771226 1:90834700-90834722 AGCCGTGTGTGCAGGAGAGAGGG - Intergenic
911102376 1:94104819-94104841 GGCTGGGTTTGGAAGACAGCCGG - Intronic
911577878 1:99599762-99599784 GGCTGACTGTGGAGGATGGAAGG - Intergenic
912075717 1:105873132-105873154 GCCTGGGTGTGGAGCAAAGAAGG + Intergenic
912382484 1:109254943-109254965 GGCTGGGTGTGGAGGACCAGAGG - Intronic
912552704 1:110494408-110494430 GGCTGTGGCAGAAGGACAGACGG - Intergenic
913258266 1:116974867-116974889 GGCAGTGGGTGCAGGACAGTAGG + Intronic
913412113 1:118563634-118563656 GCTTCTGTGTGGAGGACAAATGG + Intergenic
913997084 1:143660543-143660565 GGCTGTGTGTGCAGGCCAAATGG - Intergenic
914505169 1:148282244-148282266 GGCTGTGTGTGCAGGCCAAATGG + Intergenic
914507396 1:148301904-148301926 GGCTGTGTGTGCAGGCCAAATGG - Intergenic
915488091 1:156235993-156236015 GAGTGTGTGTGGAGGAAAGGAGG + Intronic
916515556 1:165513181-165513203 GGCTGTGAGGGGAGCACACATGG + Intergenic
916789850 1:168115670-168115692 GGCGGGGTGTGGTGGTCAGAAGG + Intronic
919749001 1:201024940-201024962 GGGTGTGAGTGGAGGAGGGAAGG - Intergenic
920290160 1:204916427-204916449 GGCTGTGATTTGAGGATAGATGG - Intronic
920387503 1:205579263-205579285 TCCTGTGTGGGGAGGACACAGGG + Intronic
920687544 1:208120810-208120832 GTCTGTGAGGGGAGGTCAGAGGG + Intronic
920958233 1:210639207-210639229 GGATGAGTTGGGAGGACAGAAGG - Intronic
921182987 1:212645984-212646006 GGCTGGGTTTGGTGGGCAGATGG + Intergenic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
921440644 1:215182201-215182223 GCCTGGGTGTGGAGCAGAGAGGG + Intronic
921725717 1:218521306-218521328 GTCTGTGTGTGGGGGCAAGAAGG + Intergenic
922068853 1:222170839-222170861 GCCTGGGTGTGGAGCAGAGAGGG - Intergenic
922228447 1:223665654-223665676 GGCTCTGTAGGGTGGACAGAAGG + Exonic
922452325 1:225747052-225747074 GGTTGGGTGTGGAGGATACAGGG + Intergenic
922505578 1:226123655-226123677 GACTGTGTGTGAGGGACAGCGGG - Intergenic
922588511 1:226754086-226754108 GGCTGCTGGTGGAGAACAGAGGG + Intergenic
922770882 1:228182459-228182481 GGGTGTGTGTGGTGGGGAGATGG + Intergenic
923071432 1:230568356-230568378 GCCTGAGTGTGGAGGCCCGAGGG + Intergenic
924310843 1:242741778-242741800 GGAGGTGATTGGAGGACAGAAGG - Intergenic
924333297 1:242962335-242962357 GGGTGTGTGTGGAGTGTAGAGGG + Intergenic
924435549 1:244037450-244037472 GGCTGGCTGTGGAGGGTAGAGGG + Intergenic
924597855 1:245463052-245463074 AAGTGTGGGTGGAGGACAGAGGG - Intronic
1062831386 10:608252-608274 GGCTGTGTGTGGGGGGCTGTGGG - Intronic
1062889494 10:1047630-1047652 GGCTGTGTGGTGTAGACAGACGG - Intronic
1062904494 10:1170685-1170707 AGCTCTGTGTGGAGGGGAGAGGG - Intergenic
1063496344 10:6512688-6512710 AGCTTTGTGTGTTGGACAGAAGG - Intronic
1064143232 10:12807522-12807544 GGCAGGGTGAGGAGGAGAGAGGG - Intronic
1064680772 10:17809130-17809152 GGCGGGGTGGGGAGGAGAGAGGG - Intergenic
1065752829 10:28903429-28903451 ACCTGTGTGGGGAGGAGAGAAGG + Intergenic
1066101947 10:32125258-32125280 GGCTGTGTGTCAAGGACATTGGG + Intergenic
1066195568 10:33096272-33096294 GGCTGCCTGTGGAGCACAGCTGG - Intergenic
1066415044 10:35213957-35213979 GCTTGGGTCTGGAGGACAGAGGG + Intergenic
1066589112 10:36973501-36973523 TACTGTGTGTGGTGGAGAGAGGG + Intergenic
1066609812 10:37230849-37230871 AGGTTTGTGTGGAAGACAGAAGG + Intronic
1067154079 10:43760410-43760432 GGTTGTGGGTGGGGGACAAAGGG + Intergenic
1067517812 10:46968553-46968575 AACTGAGTGAGGAGGACAGAAGG - Intronic
1067644438 10:48083276-48083298 AACTGAGTGAGGAGGACAGAAGG + Intergenic
1067849813 10:49747348-49747370 GGCAGTGTGATGAGGAGAGAGGG - Intronic
1068351069 10:55845914-55845936 GGCAGTGTGTGGGGGGCAGCAGG - Intergenic
1070769704 10:79075055-79075077 GGCAGGCTGTTGAGGACAGACGG + Intronic
1070839673 10:79475406-79475428 GGCTGTGAGGGGTGGGCAGAGGG + Intergenic
1070854214 10:79593676-79593698 GTAGCTGTGTGGAGGACAGAAGG + Intergenic
1071523719 10:86346404-86346426 GCCTGTGTTTGGAGGGCAGCTGG + Intronic
1072001708 10:91201581-91201603 GGCTGTGGGTGGAGGGAGGAGGG - Intronic
1072374850 10:94804012-94804034 GCCTGGGTGTGGAGCACAGAGGG + Intronic
1072384288 10:94908623-94908645 GGCAGTGGGTGCAGGACAGTGGG + Intergenic
1072443995 10:95481919-95481941 GGCTGTGTGTGTAGGAGCAAAGG - Intronic
1072666093 10:97393632-97393654 GGCTTTTTGTGGAGGGGAGAAGG - Intronic
1072729696 10:97837407-97837429 GGTGGTGTGTGGGGGCCAGATGG + Intergenic
1072741978 10:97915076-97915098 GGCTGAGTGTTCAGGACAGCGGG - Intronic
1073093820 10:100968178-100968200 GGATGTGTGTGGCGGGGAGAGGG - Intergenic
1073332834 10:102681925-102681947 GTCTGTGGGTGGAGGAGGGATGG + Intronic
1073432389 10:103494609-103494631 GGCTGGGGGTGGAGGGCAGCCGG + Intronic
1074386529 10:113020764-113020786 GGGGGTGTGAGGGGGACAGAGGG + Intronic
1075087963 10:119426190-119426212 GGCTGTGAGTGGGGTTCAGAAGG - Intronic
1076131580 10:128017514-128017536 GCCTGTGTGGGGAGGGCATATGG - Intronic
1076754968 10:132564672-132564694 GGCAGTGAGTGCAGGGCAGACGG + Intronic
1076982635 11:213000-213022 GGCTGTGAGTGGAGACCCGAGGG - Intronic
1077182836 11:1224199-1224221 GGACGTGCGTGGAGGACAGGAGG - Intronic
1077308866 11:1879744-1879766 GGCTGGGAGAGGGGGACAGAGGG + Intronic
1077723989 11:4655160-4655182 GGCTATGTGTTCAGGACAGAAGG - Exonic
1077771326 11:5221978-5222000 GGCAGTGGGTGCAGGACAGTAGG - Intergenic
1077940879 11:6841349-6841371 GCCTGTGTGTGAGAGACAGAGGG + Intergenic
1078423379 11:11230243-11230265 GGCTGAGTGTAGGGGAAAGAGGG - Intergenic
1079256316 11:18834394-18834416 GACTGAGTGTGGAGTAGAGAGGG + Intergenic
1080057304 11:27919679-27919701 GGCTGGGTTTGGGGGAGAGATGG - Intergenic
1080587306 11:33693691-33693713 AGCAGTGTGGGGAGTACAGAGGG - Intergenic
1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG + Intergenic
1080831078 11:35893946-35893968 AGCTGGGTGTTGAGGAAAGAAGG - Intergenic
1080924671 11:36743997-36744019 GGCTGGCTGTTGAGGTCAGAGGG + Intergenic
1081704106 11:45170680-45170702 GGTTTTGAGTGGAGGGCAGAGGG + Intronic
1081868931 11:46374587-46374609 AGCTGTCTGTGGGAGACAGAGGG - Exonic
1081909947 11:46694341-46694363 GGCTCTCGGTGGAGGCCAGATGG - Intronic
1081965224 11:47165212-47165234 AGCTGTGGGGGCAGGACAGAAGG + Exonic
1082619156 11:55399259-55399281 GACTGTGGGTGCAGGACAGTGGG - Intergenic
1082833124 11:57634108-57634130 GGATGTTTGTGGACAACAGACGG + Intergenic
1083061404 11:59876636-59876658 TACTTTGTGTGGAGGACAAACGG + Intergenic
1083661862 11:64255187-64255209 GGCGGTGAGTGGGGGACACAGGG - Intronic
1083901327 11:65644934-65644956 AGCTGTGGGTGGGAGACAGAAGG - Exonic
1084440852 11:69172247-69172269 GGCTGTGTGTGCTGTAGAGATGG - Intergenic
1084486441 11:69450936-69450958 GGCTGTGTTTGGAAGGCTGATGG - Intergenic
1084557892 11:69885720-69885742 GGCTGAGGGGGGAGGGCAGAAGG + Intergenic
1084728291 11:71056433-71056455 GGATGTGTGTGGATCACAGTGGG - Intronic
1084891793 11:72240328-72240350 GGCTGCGTGCGGAGGGCCGAAGG - Intronic
1085417331 11:76328091-76328113 GGGTGTGGGTGGAGGAGGGAAGG + Intergenic
1085471101 11:76758658-76758680 GGCTGAGTGTGAAGGGCATAGGG + Intergenic
1085789239 11:79482503-79482525 ACCTGGGGGTGGAGGACAGAAGG + Intergenic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1086494064 11:87384612-87384634 GCCTGGGGGTGGAGCACAGAGGG - Intergenic
1088964056 11:114700122-114700144 TGCTGTGTCTGGAATACAGAAGG - Intronic
1089040545 11:115444957-115444979 GGCTATGTGTGAAGCACAGTAGG + Intronic
1089142239 11:116294892-116294914 AGCTGCTTGTGGAGGACAAAAGG + Intergenic
1089275789 11:117335190-117335212 GACTGTGTGTGTAGCACAGTGGG + Intronic
1089300209 11:117494048-117494070 GGCTGTGTTTGGAGAAGTGAGGG - Intronic
1089308044 11:117538958-117538980 GGCTGTGTGCTGGGGACAGAAGG - Intronic
1089422331 11:118341137-118341159 GGCTGTGGGTGGAGACCAGCTGG + Intronic
1089687614 11:120166744-120166766 GGCTGCTTGGGGAGGAGAGAGGG + Intronic
1090247023 11:125223849-125223871 GGCTGTGAGTGAAGGCCACAAGG + Intronic
1090255993 11:125284813-125284835 AGCTGGGGGTGGAGGACAGCAGG - Intronic
1090457938 11:126866075-126866097 GCCTGTCTTTGGAGCACAGAAGG + Intronic
1090483274 11:127086620-127086642 GCCTGGATGTGGAGCACAGAGGG - Intergenic
1091254455 11:134171811-134171833 TGCTGTGTTTGGAGGACAGCCGG - Intronic
1091312317 11:134583407-134583429 GGCTTTGTGTGGGGGCGAGATGG + Intergenic
1091619670 12:2076847-2076869 TGCTGTGTGTGAAGGACACTGGG + Intronic
1091842292 12:3629817-3629839 GGCTGGGTGTGAAGGACACAAGG + Intronic
1092091316 12:5805805-5805827 GGCTGTGTGTGGAGGGCCATTGG + Intronic
1092369004 12:7900981-7901003 GGCTGTGTGGGCAGCACTGATGG + Intergenic
1092765501 12:11849489-11849511 GGCTGGGTGTCGAGGAATGAAGG + Intronic
1093077962 12:14776408-14776430 TGCTGTGTGTGGATGAATGATGG + Intronic
1093738130 12:22648131-22648153 GGTTGTCTGTGGAGGAAGGAGGG - Intronic
1093809316 12:23472866-23472888 GCCTGGGTGTGGAGGAAAAAGGG - Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094069040 12:26392569-26392591 GGCAGTGTCTGGAGAACAGTAGG + Intronic
1094810516 12:34133464-34133486 GACAGTGGGTGCAGGACAGAGGG + Intergenic
1096801867 12:54115718-54115740 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1097146223 12:56941174-56941196 AGGAGTGTGTGGGGGACAGAGGG - Intergenic
1097149498 12:56966119-56966141 GACTGTGGGTGCAGGACAGTGGG + Intergenic
1097151940 12:56985651-56985673 AGGAGTGTGTGGGGGACAGAGGG - Intergenic
1098003202 12:65967779-65967801 GGCTGAGGATGGAGGAGAGAGGG - Intergenic
1098465699 12:70783847-70783869 GGCTGTGTGGGGGGGACGGGGGG + Intronic
1100091027 12:90971074-90971096 GGCAGTGTCTTGAAGACAGAAGG - Intronic
1101205317 12:102481377-102481399 GTGTGTGTGTGTATGACAGAGGG + Intergenic
1101440248 12:104698563-104698585 GGCTGTGTCTGGTATACAGAAGG + Intronic
1101493932 12:105236035-105236057 GGCTGGGTTGGAAGGACAGAGGG + Exonic
1101556953 12:105819013-105819035 GGGTGTGTGTGGAAGGAAGATGG + Intergenic
1101840065 12:108321746-108321768 GGCTGTGTGGGGAGGAGCTAGGG - Intronic
1102016906 12:109654231-109654253 GGCTGTGACTGGGGGAGAGAGGG - Intergenic
1102053187 12:109878186-109878208 GGCTGGTTTTGGAGGAAAGAGGG - Intronic
1102255759 12:111414084-111414106 GGCTGGGTGTGGGGAACAGTAGG + Intronic
1102405874 12:112673812-112673834 GGCTGTGTGGGGAGGGAAGTAGG - Intronic
1102539808 12:113610561-113610583 GGGTGTGTGGGGTGGAGAGAGGG - Intergenic
1102576925 12:113861504-113861526 GTGTGTGTGTGAAGGAGAGAAGG + Intronic
1102813534 12:115844102-115844124 GGCTTTGGGTGGAGAATAGATGG - Intergenic
1103818427 12:123677741-123677763 AGCTGTAGGTGGAAGACAGAGGG - Intronic
1103866382 12:124055218-124055240 GGCTCTGTGTGGAAGAGAAAGGG - Intronic
1104370166 12:128217321-128217343 GGCTGTATGTGAAGGGGAGAGGG - Intergenic
1104462030 12:128963833-128963855 GGCTGTGGGTGGTGCGCAGATGG + Intronic
1104464702 12:128980740-128980762 AGCTTTGTGTGGAAGGCAGACGG + Intronic
1104655160 12:130568925-130568947 GGCTGTGTGAGGAGGGCACGTGG - Intronic
1104664221 12:130635911-130635933 GGCTGTGTGGAGAAGACAGTAGG - Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104969814 12:132526192-132526214 GCCTGTGGGTGGAGGGCAGGCGG + Intronic
1105005979 12:132720847-132720869 GCCTGTGCAGGGAGGACAGAGGG - Exonic
1105236134 13:18555198-18555220 GCCTGAGTGTGGAGTAGAGAGGG + Intergenic
1105280466 13:18960002-18960024 GTCTGCGGGTGGAGGACAGATGG - Intergenic
1106037079 13:26052483-26052505 GGCTGTGTTTGGTGGACTGGAGG + Intergenic
1106593740 13:31119849-31119871 GGATGTGTGTGGAGAAAAGTGGG + Intergenic
1106744467 13:32685179-32685201 GGTTGTGCGTGGAGGATAAATGG + Intronic
1108427240 13:50315097-50315119 GGCTGGGTGAGCAGTACAGAGGG - Intronic
1109269336 13:60236870-60236892 CGGTGGGTGTGGAGAACAGATGG - Intergenic
1109323006 13:60833196-60833218 GGCAGTGGGTGCAGGACAGTGGG - Intergenic
1109995927 13:70125903-70125925 GGTTGTGGGAGGAGGGCAGAGGG + Intergenic
1110763247 13:79253429-79253451 AGCTGTGTGTGGAGGAAAGAAGG - Intergenic
1112135246 13:96570942-96570964 TTCTGTGTGTGGATGAGAGAAGG + Intronic
1112237437 13:97649051-97649073 GGATGTGGGTGGAGGGGAGAGGG - Intergenic
1112895057 13:104288662-104288684 GCCGGTGTGAAGAGGACAGAAGG + Intergenic
1113293438 13:108931343-108931365 GTCTGTGAATGAAGGACAGAAGG + Intronic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1113568897 13:111339412-111339434 GGGAGTGTGTGGAGGATAGATGG - Intronic
1113865258 13:113517803-113517825 GACTGTGGGTGGAGGGAAGAGGG + Intronic
1113866923 13:113532519-113532541 GCCTCTGTGTGGAGAGCAGATGG + Intronic
1113882678 13:113636431-113636453 AGCTGTGTGTGGCGGTCAGCGGG + Intronic
1113935113 13:113989771-113989793 GGATGGGTGTGCTGGACAGATGG - Intronic
1114807817 14:25857850-25857872 GGCTGTGGGTGCAGGACAGTGGG - Intergenic
1114887281 14:26869437-26869459 GGCTGAGTGTGGAGGACTCTTGG + Intergenic
1115791417 14:36883074-36883096 GGCTGTGGGGTGAGAACAGATGG - Intronic
1117017881 14:51536938-51536960 GACTGTGTGTGGGGGGCAGGGGG - Intronic
1117732279 14:58735445-58735467 GTGTGTGTGTGTAGGAAAGAGGG - Intergenic
1117871996 14:60210875-60210897 GGCTGAGTGGGGAGGATAGCTGG - Intergenic
1118306790 14:64661757-64661779 CGCTGTGTGTGGAGGAGAAAGGG + Intergenic
1119187116 14:72650840-72650862 GGGTGTCTGTGGAGGAGAGATGG - Intronic
1119193394 14:72699932-72699954 AGCTGTGGGAGGAGGAAAGAGGG + Intronic
1119231085 14:72980387-72980409 TGCAGTGTGTCGAGGTCAGATGG - Intronic
1120121054 14:80680519-80680541 GTCTGCGTGTGGAGCAGAGAGGG - Intronic
1120498668 14:85266985-85267007 TGCTATGTGTGGAGAACACAAGG + Intergenic
1121329265 14:93039908-93039930 GGCCCTGTGGGGAGGACAGAGGG - Intronic
1121988253 14:98529112-98529134 GGCTGTGTGTGTAATACACATGG - Intergenic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122640121 14:103155121-103155143 GGTTGTGTGCTGAGGCCAGAGGG + Intergenic
1122811118 14:104288587-104288609 GGCTGTGAGTGAATGACGGAGGG - Intergenic
1122857974 14:104569016-104569038 GGCAGTGGGAGCAGGACAGAAGG - Intronic
1122951554 14:105047809-105047831 GGCTGTGGGCGGAGGGCAGCAGG - Intergenic
1123768374 15:23504190-23504212 GGCATTGTGTGGAGAACAGCAGG + Intergenic
1124793348 15:32751091-32751113 GACTCTGTGTGCAGGAGAGATGG + Intergenic
1126688488 15:51268249-51268271 GGATGGGTGTGGAGGAAGGATGG - Intronic
1126933546 15:53681275-53681297 GGCAGCGTGGGGAGGGCAGATGG + Intronic
1126971151 15:54113097-54113119 GGTTGAGTGTGGAGGAGAGGTGG - Intronic
1128381204 15:67114349-67114371 GGTTATGTGTGGCGCACAGATGG + Intronic
1129269520 15:74412011-74412033 GTCTGTGTATGGTGGACAGAGGG + Exonic
1129525730 15:76212854-76212876 GGTGGTGTATGCAGGACAGAGGG - Intronic
1129703771 15:77782999-77783021 GGCTGTGTCTGGAGACCAGGAGG - Intronic
1129846565 15:78770547-78770569 AGCTGTGAGAGGAGGACTGAGGG + Intronic
1130096592 15:80860808-80860830 AGCTGTGTGGTGAGGTCAGAGGG - Intronic
1130529852 15:84738529-84738551 TGATGTGTGTGGAGGACAACAGG + Intergenic
1131024389 15:89127801-89127823 GGCTGAGTATGGTGTACAGACGG - Intronic
1132254638 15:100365395-100365417 GACAGTGTGTGCAGGACAGTGGG + Intergenic
1132310566 15:100854468-100854490 GGCTGTGTGTGCAGGAGAGCAGG + Intergenic
1132399855 15:101498579-101498601 GGCTGCGGGTGCAGGTCAGAAGG - Intronic
1132571866 16:647762-647784 GGCTGTGGGAGGAGGGCAGTCGG - Exonic
1132846768 16:2004351-2004373 GGCCGTCTGTGGAGGGCACAGGG - Intronic
1133723099 16:8513270-8513292 GGCTGGCTGTGCAGAACAGAGGG + Intergenic
1133732700 16:8590216-8590238 GGCTGGGCGTGGAGGGCCGAGGG - Intergenic
1133845472 16:9449306-9449328 GGTTGGGGGTGGAGGAAAGATGG + Intergenic
1135771540 16:25221648-25221670 GGGTGTGTGTGTGGGACAGTGGG + Intronic
1136278102 16:29191495-29191517 GGCGGAGGGTGGAGGAGAGATGG - Intergenic
1136607828 16:31348442-31348464 GTCTGTGGGTGTAGGACGGATGG + Intergenic
1137758360 16:50920279-50920301 GGCTGTGTGAAGAGGGCAGCTGG + Intergenic
1138604843 16:58081989-58082011 GTCTGTGTGTGCAAGACAGAGGG + Intergenic
1139342563 16:66278024-66278046 GCCTGGGTGTGGAGAAGAGAGGG - Intergenic
1139958370 16:70704124-70704146 GGCTGTGTGTGGATGCCAGGTGG - Intronic
1140449354 16:75057966-75057988 GGCTGTGTGTGGAGAAAAGTAGG + Intronic
1140503760 16:75456843-75456865 GGCGGTGGGTGGTGGACAGGGGG - Intronic
1140511055 16:75508815-75508837 GGCGGTGGGTGGTGGACAGGGGG - Intergenic
1140511597 16:75512675-75512697 GGCTTTGCGTGGAGAATAGATGG - Intergenic
1140736032 16:77898602-77898624 GGCTGTGTGTGCAGGGCTTAAGG + Intronic
1141398716 16:83727726-83727748 GCCTGTGTGTTCAGGACAGGAGG + Intronic
1141614884 16:85204809-85204831 GGCTGGGTGTGGGGGACTGGGGG - Intergenic
1141676826 16:85522175-85522197 GGCTGTGGGAGGAGGAGAGGAGG - Intergenic
1142082478 16:88157535-88157557 GGCGGAGGGTGGAGGAGAGATGG - Intergenic
1142387238 16:89773490-89773512 TGCTGTGTGTGGCAGACGGAGGG + Intronic
1142478546 17:204365-204387 GTGGGTGGGTGGAGGACAGATGG - Intergenic
1142600312 17:1050633-1050655 GTCTGTGGGGGAAGGACAGACGG + Exonic
1142968152 17:3593676-3593698 GCCACTGTGTGGAGGACAGCGGG - Intronic
1143766586 17:9141695-9141717 GGCTGTGTGTGTGAGAGAGAAGG + Intronic
1143852327 17:9822153-9822175 GGCTGTGTGAGGATGCCAGATGG - Intergenic
1143976157 17:10831486-10831508 GGCTATGTGCAGAGGAGAGATGG + Intronic
1144770888 17:17758818-17758840 GTCTGTGTGTTCTGGACAGAGGG + Intronic
1144889622 17:18487087-18487109 GGGAGGGTGAGGAGGACAGATGG + Intronic
1144955274 17:19015875-19015897 GGCTGTGTCTGGAGAACAGGTGG + Intronic
1145142589 17:20457209-20457231 GGGAGGGTGAGGAGGACAGATGG - Intronic
1145391073 17:22455995-22456017 GACTGTGTGGTGTGGACAGAGGG + Intergenic
1145716562 17:27028734-27028756 GGCAGTGGGTGCAGGACAGTAGG + Intergenic
1146273568 17:31500029-31500051 GGCTCTGTTTGCAGGGCAGAGGG + Intronic
1146645984 17:34578040-34578062 GGCTCTGTGTGGGGGAGAAAGGG - Intronic
1146915541 17:36676183-36676205 GGCTGTGTTTGAGGGTCAGAGGG - Intergenic
1147149906 17:38508718-38508740 GGCTGTGGGTGGAGGAGAGAGGG + Intronic
1147322263 17:39653423-39653445 GGCTGTGTGGGAGGGACAGGAGG + Intronic
1148110918 17:45144357-45144379 GCCTCTGTGTGGAGGGGAGAGGG + Intergenic
1148178136 17:45585045-45585067 GGCCGGGTGGGGAGGCCAGAGGG + Intergenic
1148346764 17:46908488-46908510 GGCTGGATGTGGAAGAGAGAAGG + Intergenic
1148444344 17:47728377-47728399 GGCTGGGAGTAGAGGAAAGAGGG + Intergenic
1149427630 17:56570285-56570307 GGCTGTGAGAGGAGGGGAGATGG - Intergenic
1149518825 17:57302950-57302972 GGCCGAGTGAGGAGGAGAGAGGG + Intronic
1149979353 17:61297284-61297306 GGCTGGGGATGGAGGAGAGAAGG + Intronic
1150408033 17:64919335-64919357 GGCCGGGTGGGGAGGCCAGAGGG + Intronic
1151381296 17:73727471-73727493 GGGTGTGTGTGGAGGAGAAAGGG + Intergenic
1151725623 17:75882102-75882124 GGCTGTGGGTGGGGAGCAGAGGG - Intronic
1152320339 17:79605426-79605448 GGCTGTGAGTGGAAGCCAGCTGG - Intergenic
1153314687 18:3710356-3710378 AGCTGGGTGTGGAGGAGAAAGGG - Intronic
1153940762 18:9974460-9974482 GGTTGTGTGTGTGGGAGAGAGGG + Intergenic
1154513408 18:15134800-15134822 GCCTGAGTGTGGAGTAGAGAGGG - Intergenic
1156084250 18:33379950-33379972 GGCTGGGTGTGGAGCAGAGAGGG + Intronic
1156464715 18:37341508-37341530 GGCAGTGAGTGGAGGGCATAAGG + Intronic
1156558922 18:38099425-38099447 GGCTTTCTGGGGAGAACAGAAGG + Intergenic
1157220289 18:45824688-45824710 GGCTGTGTGTGGTGAAGAGGAGG + Intergenic
1157245919 18:46055223-46055245 GGATGTGTATGAGGGACAGAGGG - Intronic
1157279469 18:46336061-46336083 GGGTGTGTGAGGAAGAAAGAGGG + Intronic
1157531026 18:48420861-48420883 GGCTGTGTGTGGGTGGGAGAGGG - Intergenic
1157574464 18:48734213-48734235 TGCTGGGGGTGGGGGACAGAAGG - Intronic
1157920181 18:51706579-51706601 GACAGTGGGTGCAGGACAGAGGG - Intergenic
1157958210 18:52122941-52122963 GGCTGTGGGAAGAGAACAGAAGG + Intergenic
1157966542 18:52215231-52215253 GTGTGTGTGTGGTGGAGAGAAGG - Intergenic
1158054373 18:53261201-53261223 GGCAGTGGGTGCAGGACAGTGGG - Intronic
1158676220 18:59521040-59521062 GGCTGAGGGATGAGGACAGATGG - Intronic
1159936742 18:74374606-74374628 GGCTGTGACAGCAGGACAGAGGG + Intergenic
1160048013 18:75405901-75405923 GGCTGTGTGTGGATGAAGGAAGG + Intergenic
1160124684 18:76160364-76160386 GGTTGGGTGTGGAGAAGAGATGG - Intergenic
1160179039 18:76618686-76618708 GGCTGTGTCTTGAGGGAAGAAGG + Intergenic
1160506880 18:79432322-79432344 GCCTGTGTGGTGAGGACAGTCGG + Intronic
1160507946 18:79437678-79437700 GGCAGAGGGTGGAGGGCAGAGGG - Intronic
1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG + Intronic
1160841216 19:1147768-1147790 GCCTGTGTGTGGGGGAGGGATGG - Intronic
1161210668 19:3063562-3063584 GGCTGTGGGAGGAGGAGGGACGG + Intergenic
1161429774 19:4224757-4224779 GTCTGGATGTGGAGGACACAGGG - Exonic
1161519997 19:4718556-4718578 GGCAGTTTGGGTAGGACAGAGGG - Intronic
1161642910 19:5435576-5435598 GGCTGTGGGTAGAGGAGGGATGG - Intergenic
1162349164 19:10138405-10138427 GGCAGTGTGTGGAGGAGCGACGG + Intronic
1162858302 19:13486904-13486926 GGCTGCGTGTGTAGGGAAGAAGG - Intronic
1163479841 19:17548559-17548581 GAAGGTGTGTGGAGAACAGAGGG + Intronic
1164699866 19:30277699-30277721 GCCTGTGTGCGGAGGCCTGATGG + Intronic
1164927742 19:32143521-32143543 GGATGTGTGAGCAGGAGAGAGGG - Intergenic
1165361840 19:35341623-35341645 GGCTGGGAGTGGAGCAGAGAAGG + Intronic
1165490179 19:36118869-36118891 GGCTGTGTGTGGGGAACAGGTGG + Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1165778960 19:38421054-38421076 AGCTATGGGTGGAGGGCAGAGGG - Intronic
1165790522 19:38488962-38488984 GGCTGTGTGGGTGGGACACAGGG + Intronic
1165860173 19:38905272-38905294 GGCTGTGTGTGGCGGAGCGTAGG + Exonic
1165901005 19:39169361-39169383 GGCTGTGTGTGCCACACAGATGG + Intronic
1166256967 19:41613555-41613577 GGCAGTATGGGGAGGACAGAGGG + Intronic
1166258316 19:41620968-41620990 GGCTGTGTGTGCAGGACACTGGG + Intronic
1166991511 19:46695607-46695629 GCTTGTGTGCGGAGGGCAGATGG + Intronic
1167270603 19:48503618-48503640 GGCTGTGTGTGGTGAAAAGCAGG - Intronic
1167304131 19:48697001-48697023 CGCTGGGTGTAGGGGACAGAGGG + Intronic
1167328711 19:48840937-48840959 GGCAGTGAGGGGAGGACAGTGGG - Intronic
1167618496 19:50548872-50548894 GGCTGTGGGTGGGGGAGAGAAGG + Exonic
1167710472 19:51107491-51107513 TGCTGTGTGGGGAGGACTGTTGG + Intronic
1168028068 19:53658043-53658065 GGCGGAGTCTGTAGGACAGATGG - Intergenic
1168124603 19:54276500-54276522 AGCTGTGTGTGCAGGGCAGGGGG - Intronic
1168177384 19:54635038-54635060 AGCTGTGTGTGCAGGGCAGGGGG + Intronic
925342279 2:3145877-3145899 AGCTCTGTGTGAAGGACAGGCGG - Intergenic
925505100 2:4553858-4553880 GGCTTTGTGTAGAGGGCAGAGGG - Intergenic
925607558 2:5673800-5673822 GGCCGGGGGTGGGGGACAGAGGG + Intergenic
926168393 2:10535769-10535791 GGCAGAGTGCGGAGGGCAGATGG + Intergenic
926296753 2:11574477-11574499 GCCTGTGGGTGGAGGGCAGTGGG + Intronic
926451528 2:13010327-13010349 GCTTTTTTGTGGAGGACAGAGGG + Intergenic
926676403 2:15626182-15626204 GGGTATGTGTGGAGGGGAGAGGG - Intronic
927085200 2:19668397-19668419 GGATGTGTTTGCAGGACAGGAGG + Intergenic
927095662 2:19746036-19746058 AGCTGGGAGAGGAGGACAGAGGG + Intergenic
927147642 2:20177477-20177499 AGGTGTGTGTAGAGGATAGATGG + Intergenic
927637602 2:24827505-24827527 GGCTGTGAGTGCAGGCCAGGAGG + Intronic
927651059 2:24914049-24914071 GGCTGGGTGAGGAGGAAGGAGGG - Intronic
927705480 2:25294076-25294098 AGCTGGGTGTGGAGGAAGGAAGG - Intronic
928112789 2:28524121-28524143 GGCTGGGTGGTCAGGACAGATGG + Intronic
928871021 2:35979683-35979705 GGCTGTGTGAGGATGAGAGATGG - Intergenic
929381387 2:41358599-41358621 GACAGTGTGTGCAGGACAGTGGG + Intergenic
930046987 2:47181121-47181143 GCCTGTGTGTGGAGTACACCTGG + Intergenic
931251116 2:60531228-60531250 GTCTGTGTGTGCAGGACCGTCGG - Intronic
931778844 2:65563014-65563036 AGCTGTGTGGGGACCACAGAAGG - Intergenic
932413748 2:71561731-71561753 GGCTGTGAGGGACGGACAGATGG - Exonic
932456506 2:71852859-71852881 GGGTGTGTGGGGTGGAGAGAAGG + Intergenic
932463859 2:71900765-71900787 GGCAGAGTGAGGAGGAGAGATGG + Intergenic
933547202 2:83729690-83729712 GGCTAGGTGTGGAGGCCAGAAGG + Intergenic
933774957 2:85766329-85766351 GGCTGGGTGTGGGGGAGGGAGGG - Intronic
933778079 2:85783851-85783873 GGCTGTGTGTGGGGGGCGGGGGG - Intronic
934127778 2:88915322-88915344 GGCCGTGTCTCCAGGACAGAGGG - Intergenic
934552570 2:95271410-95271432 GGCTGTGTGAGGCAGCCAGAGGG + Intergenic
935057343 2:99579061-99579083 GGCTGTCTGTGAAGACCAGAAGG + Intronic
935305754 2:101734842-101734864 GGGTGATTGTGGAGGAGAGAAGG + Intronic
936057621 2:109272699-109272721 GGCTGTGTGTGGTCAGCAGAGGG + Intronic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937083311 2:119155874-119155896 AGTTGTGGGTGGAGGTCAGAGGG - Intergenic
937090916 2:119205612-119205634 GGCTGTGTGTGGAAGGCAAAGGG + Intergenic
937921249 2:127133219-127133241 GGTCCTGTGTGGAGGCCAGAGGG - Intergenic
938306398 2:130259177-130259199 GGCTTTGTGTGGAGCCAAGATGG + Intergenic
938513653 2:131979411-131979433 GCCTGAGTGTGGAGTAGAGAGGG - Intergenic
938716619 2:134027691-134027713 AGCTGGGGGCGGAGGACAGAGGG + Intergenic
940004904 2:149001526-149001548 GGCTTTGGGTGGAGGAGTGATGG + Intronic
940005946 2:149009826-149009848 GGGTGTGTGTAGAGGAAAGGGGG - Intronic
941018115 2:160379917-160379939 GGCTGGGTGTGGAGATCAGTGGG + Intronic
941604496 2:167580555-167580577 GGCTGGGTAGGGAGGACACAGGG - Intergenic
942816825 2:180061652-180061674 AGCTGAGAGTGGAGGAGAGAGGG + Intergenic
943912297 2:193584295-193584317 GCCTGGGTGTGGAGCAGAGATGG - Intergenic
946170564 2:217892874-217892896 GGCTGTGGGTGGATGAGAGGAGG + Intronic
946814578 2:223563701-223563723 GGCTGTCTCTGGAAGGCAGATGG - Intergenic
948204322 2:236154752-236154774 TGCTGTGTGGGGATGACACAAGG - Intergenic
948229828 2:236341744-236341766 TGCTGTGTGTGGTGGGGAGAAGG + Intronic
948371775 2:237494208-237494230 GGCAGAGGGTGGAGGGCAGAGGG + Intronic
948564645 2:238876131-238876153 GGGTGTGGGTGGAGGGCGGATGG + Intronic
948627224 2:239276590-239276612 GCCTGTGTCTGGAGAGCAGATGG - Intronic
948850311 2:240702408-240702430 CACTTTGTGTGGAGGTCAGAGGG - Intergenic
948883356 2:240871310-240871332 GGCTGTGGGTGGAGCTCAGAGGG - Intronic
948918344 2:241049796-241049818 GGCTGGGGGCGGGGGACAGAGGG - Exonic
1169040691 20:2492873-2492895 CCCTGTGTGTGGAGCACAGCTGG + Intronic
1169111780 20:3038795-3038817 GGCTGTGTTTGGTGGACAGGAGG - Intronic
1169315086 20:4583815-4583837 GGCGGTGGGTGGAGGGTAGAAGG + Intergenic
1170245881 20:14220804-14220826 GGCTGTGTGTTCAGGAGAGGAGG + Intronic
1170546515 20:17439441-17439463 GGCTGTGAGTGGTGAAGAGATGG - Intronic
1171237489 20:23539377-23539399 TGTAGTCTGTGGAGGACAGAGGG + Intergenic
1171257494 20:23701197-23701219 ACCTGGGTGTGGAGTACAGAGGG - Intergenic
1171302283 20:24073781-24073803 GGGGGTGTGGGGAGGAGAGACGG + Intergenic
1171794844 20:29558748-29558770 GGCTGTGTCTGAAGGGCAGCAGG - Intergenic
1171853612 20:30325517-30325539 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1172207999 20:33178132-33178154 GGCTGTGTCTGGAAAACACAGGG - Exonic
1174285679 20:49471313-49471335 TGCTGTGTGTGGAGACCAGACGG + Intronic
1174404806 20:50296209-50296231 GCCTGTGTGTGGAGATGAGAGGG + Intergenic
1174428287 20:50448873-50448895 GGCGGCGTGTGCAGGGCAGAGGG - Intergenic
1174595119 20:51677734-51677756 TACTGTGTCTGGAGGATAGAAGG - Intronic
1175764506 20:61583163-61583185 GGCTCTGCGGGGGGGACAGAGGG + Intronic
1175995267 20:62809501-62809523 GGGTGTGGGTGGGGGACATAAGG - Intronic
1176780132 21:13183485-13183507 GCCTGAGTGTGGAGTAGAGAGGG + Intergenic
1177977787 21:27872502-27872524 GCCTGAGTGTGGAGTAGAGAGGG + Intergenic
1178134199 21:29608336-29608358 GAGTGTGTGTGGAGTATAGAAGG + Intronic
1178878231 21:36428889-36428911 GAGTGTGTGCTGAGGACAGACGG + Intergenic
1179051922 21:37895718-37895740 GGCTGTGTGATGAAGACAAAGGG + Intronic
1179654805 21:42838235-42838257 GGCTGTGGAAGGAGGCCAGAAGG - Intergenic
1180094947 21:45552115-45552137 GGCTGTGTGGTGGGGACTGACGG + Intergenic
1180230926 21:46426442-46426464 GGAGGTGTGTGGGGGGCAGAAGG + Intronic
1180248248 21:46562659-46562681 GGCTGAGTGTGGGGAGCAGAAGG + Intronic
1181804615 22:25367261-25367283 GGCAGCCTGGGGAGGACAGAGGG - Intronic
1182141739 22:27965476-27965498 GGGTGGGTCTGGGGGACAGAAGG - Intergenic
1182920265 22:34072806-34072828 TGCTGGATGTGGAGGAGAGATGG + Intergenic
1183128919 22:35813982-35814004 GCCTGTGTTTGTAAGACAGAAGG - Intronic
1183700525 22:39448512-39448534 TGCTGGGTGTGGAGGAGAGGAGG + Intergenic
1184304159 22:43584106-43584128 GGTTGTGGCTGCAGGACAGAAGG + Intronic
1184384662 22:44167266-44167288 GGGTGTTTGGGGAGCACAGAGGG + Intronic
1184521454 22:44996645-44996667 GTGTGTGTGTGTAGGACAGGTGG - Intronic
1184611432 22:45606513-45606535 GACAGAGTGGGGAGGACAGAGGG - Intergenic
1184642147 22:45878424-45878446 TGCAGGGTGTGAAGGACAGAAGG - Intergenic
1184735967 22:46398033-46398055 GGCTGGGTGAGGAGCTCAGAGGG + Intronic
1184822377 22:46918925-46918947 GGGAGTGGGTGGGGGACAGAAGG - Intronic
1185013278 22:48328333-48328355 GGCCGGGTGTGTTGGACAGAGGG - Intergenic
1185065946 22:48631803-48631825 GGCCGTGTGGGAAGGACAGCAGG + Intronic
1185095410 22:48803625-48803647 GGCTGTTTGAGGAGGGCAGCTGG + Intronic
1185119508 22:48957629-48957651 GGGAGTGGGAGGAGGACAGATGG - Intergenic
1185315330 22:50176556-50176578 GGCTGTGTGTGGATAGAAGAAGG + Intronic
1185416888 22:50715458-50715480 GGCTGTGTGGGCAGTGCAGATGG - Intergenic
949203090 3:1404454-1404476 GGCTGTTTGTGGAGGAAGGGGGG - Intergenic
949663014 3:6303706-6303728 GTCTGTGTGTGGAGTGTAGAGGG - Intergenic
949807421 3:7970869-7970891 GGCTAGGAGTGGGGGACAGAAGG + Intergenic
950240580 3:11366371-11366393 CCTTGTGTGTGGGGGACAGAGGG - Intronic
950263656 3:11559759-11559781 GGCATCCTGTGGAGGACAGAGGG + Intronic
950591332 3:13937535-13937557 GCGTGGGTGTGGGGGACAGATGG + Intronic
950712400 3:14821652-14821674 GCGTGGGTGTGGGGGACAGATGG + Intronic
951587551 3:24230975-24230997 GGCTGTCTGTGAATGTCAGATGG - Intronic
952448539 3:33408370-33408392 GTGTGTGTGTGAAGGAGAGAGGG + Intronic
954130651 3:48559069-48559091 GGCTGGGGGTAGAGGACAGCTGG + Intronic
954313837 3:49790192-49790214 GCATGTGTGTGAAGGAGAGAGGG - Intergenic
954676077 3:52316099-52316121 GGCTGTGGCTGCTGGACAGATGG - Intergenic
955606072 3:60705805-60705827 GATGGTGTGTGGAGGACAGCTGG - Intronic
955639185 3:61063900-61063922 GCTTATGTGTGGAGGTCAGAGGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956963901 3:74435915-74435937 CTCTGTGTGTAGAGGATAGATGG - Intronic
959948106 3:112148996-112149018 GCTTGTGTGTGGAGCAGAGATGG + Intronic
960603791 3:119484176-119484198 GGCTGAGGGTGGAGGTCTGAGGG + Intronic
961657059 3:128448794-128448816 GGCTATGTGTGGTAGAGAGAAGG - Intergenic
961833254 3:129635777-129635799 TCGTGTGTGTGGACGACAGAAGG + Intergenic
962358477 3:134715180-134715202 GGCTCTGTATGGAGGAGAGATGG - Intronic
962395873 3:135015011-135015033 AGGTGTGTGTGGAGGAGAGTGGG + Intronic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
963978433 3:151509619-151509641 GACAGTGTGTGCAGGACAGCGGG + Intergenic
965516784 3:169630108-169630130 TGCTGTGTGTTGAGGAGAGAAGG - Intronic
965886449 3:173452057-173452079 GACAGTGGGTGCAGGACAGAGGG - Intronic
966881611 3:184354054-184354076 GGCTGTGGGTGAAGGGCAGAGGG - Intronic
967890115 3:194358983-194359005 GGCTGTTCTTGGAGGACAGGTGG + Exonic
969210907 4:5686508-5686530 GGCAGTGTGTGGAGATCAGCTGG - Intronic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
969868056 4:10088021-10088043 GACTGTTTGAGTAGGACAGAAGG + Intronic
970067527 4:12116073-12116095 GGCTGGGTGTGGAGCAGAGAGGG + Intergenic
972430286 4:38975216-38975238 GGATGTGTGTGGAGGAGAGCAGG - Intronic
973001888 4:44961743-44961765 GCCTGAGTGTGAAGTACAGAGGG + Intergenic
973713263 4:53650270-53650292 TGCGGGGTGTGGAGGACATACGG + Intronic
974033039 4:56793374-56793396 GGCTGTGTGGGGAGGACCACTGG - Intergenic
974312768 4:60233974-60233996 AGCTGTGTGTGTAGTAGAGAGGG + Intergenic
974431808 4:61808012-61808034 GGCAGTGTATGGGGGACAGGAGG - Intronic
974515248 4:62899453-62899475 AGCTGTGTGTTCAGGACACAAGG + Intergenic
975415409 4:74099144-74099166 GGCTGTGCGAGGAGGAGAGCTGG + Exonic
975732645 4:77352914-77352936 GGCTGTGGGTGGTGGAAAAATGG + Intronic
976107594 4:81635797-81635819 GGCTGTGTGGAGAGGACACTTGG - Intronic
977108715 4:92922344-92922366 GACAGTGGGTGCAGGACAGAGGG - Intronic
977555682 4:98485355-98485377 GGTTGTGTGTGTATGAGAGAGGG + Intronic
977826926 4:101543576-101543598 GGGTGTGTGTTGAGGGCAGGGGG + Intronic
978069339 4:104447201-104447223 TGATGTTTGTGGAGGATAGATGG + Intergenic
979302542 4:119103304-119103326 GGCTTTTTGTGAAGGCCAGATGG - Intergenic
979737408 4:124104562-124104584 GCCTGGGTGTGGAGCAGAGAGGG + Intergenic
979995359 4:127425572-127425594 GGGTGTGTGTTCAGGAGAGAAGG - Intergenic
980582366 4:134771702-134771724 TGGTGTGTGTGGAAGACAGAGGG - Intergenic
982002145 4:151030928-151030950 GGCTGTGTGTGAAGAACAGATGG + Intergenic
982051461 4:151506552-151506574 TGCTGTATGTGGAGGTCACATGG + Intronic
982584850 4:157222829-157222851 GGATTGGTGTGGAGGCCAGAGGG + Intronic
983807159 4:172008877-172008899 GTCTGTGTGTAGAGGAGGGAGGG + Intronic
983963125 4:173778370-173778392 GGCTGTTGGTGGAGCACAGCAGG - Intergenic
985438862 4:189963878-189963900 GGCAGTGGGTGCAGGACAGTGGG + Intergenic
985515989 5:344813-344835 GGGTGTGTGTGGGGGACTGTAGG + Intronic
985585799 5:733324-733346 GACTGTGTGTGGGAGACAGATGG - Intronic
985589293 5:756441-756463 GGCTGTGTGTGCAGGGCCGATGG - Intronic
985599465 5:819098-819120 GACTGTGTGTAGGAGACAGATGG - Intronic
985600222 5:824728-824750 GACTGTGTGTAGGAGACAGATGG - Intronic
985604010 5:849105-849127 GGCTGTGTGTGCAGGGCCGACGG - Intronic
985659990 5:1152229-1152251 GGCCGGGTGTGCAGGGCAGAGGG - Intergenic
986048959 5:4069142-4069164 GGATGCTTGTGGAGGAGAGAAGG + Intergenic
986112727 5:4735835-4735857 GACTGTGTGTGGAGGATGCATGG - Intergenic
987025376 5:13921731-13921753 GGGTGTGTGTGGGCGGCAGATGG - Intronic
987332148 5:16866869-16866891 GGCTGTGGGTGGAGACCAGCAGG - Intronic
987669772 5:20991183-20991205 GCCTGGGTGTGGAGCAGAGAGGG - Intergenic
988548174 5:32176658-32176680 GGCTGGGGGTGGAGGGCAGCTGG - Intergenic
988606204 5:32680418-32680440 GGCTAAGTGTGAAAGACAGAGGG + Intergenic
988780025 5:34512161-34512183 GGCTGTGGGTGGAGCAGGGAGGG - Intergenic
988992707 5:36687059-36687081 GGCTGTGTGTGGTGGTCACCAGG + Exonic
989085323 5:37670297-37670319 GCCTGAGTGTGGAGGATAAATGG - Intronic
990226993 5:53665824-53665846 GACAGTGTGTGCAGGACAGTGGG - Intronic
991594515 5:68288852-68288874 CGCTGCCTGGGGAGGACAGATGG + Intronic
993002368 5:82394330-82394352 GGTTCAGTTTGGAGGACAGAGGG - Intergenic
993244228 5:85431597-85431619 GGCAGTGGGTGCAGGACAGTGGG + Intergenic
994824734 5:104698692-104698714 GCCTGGGTGTGGAGCAGAGAGGG - Intergenic
995210338 5:109530616-109530638 GGCTGTCTGTGGAGGGCTGGAGG - Intergenic
996339089 5:122416382-122416404 GGCTGAGGAAGGAGGACAGAAGG - Intronic
996382927 5:122880358-122880380 GGCTGAGGGTGGAGGAGAGGAGG + Intronic
996420474 5:123256916-123256938 GACAGTGTGTGCAGGACAGTGGG - Intergenic
996595132 5:125192124-125192146 CGCTGTATATGGAGCACAGATGG + Intergenic
997368850 5:133343228-133343250 TCCTCTGTGAGGAGGACAGAGGG + Intronic
997792451 5:136772873-136772895 GGCTATGTGTGGAGTAGAGGTGG - Intergenic
998418642 5:141963956-141963978 GGCTCTGTAAGGAGGAAAGAGGG - Intronic
998811823 5:145974198-145974220 GGCTGTGTTAGGAGGTCATATGG - Intronic
998860724 5:146441060-146441082 GGCTGGGTATGGAAAACAGATGG + Intergenic
1000526091 5:162359293-162359315 GCCTGTGGGTGAAGTACAGAAGG + Intergenic
1001057359 5:168460799-168460821 AGATGTGTGTGCAGGACACAGGG - Intronic
1001104899 5:168844502-168844524 GTCTGTGTGGGGAGGAGAGAGGG - Intronic
1001219810 5:169890882-169890904 GCTGCTGTGTGGAGGACAGATGG - Intronic
1001696754 5:173675911-173675933 GACCCTGAGTGGAGGACAGAGGG - Intergenic
1001956398 5:175850896-175850918 GGCTGTGTGTGGTGCAGAGTGGG + Intronic
1002048276 5:176554212-176554234 GGCTGTGTGTGGAGGAGCCCTGG - Intronic
1002051440 5:176573878-176573900 GGCTGTGTGGGGAGGGGAGGAGG + Intronic
1002521189 5:179794035-179794057 GGCTGTGTGTGAAGGCGAGCTGG - Exonic
1002680049 5:180954639-180954661 AGCTGAGTCTGGAGGCCAGAGGG + Intergenic
1004982229 6:21038269-21038291 TTCTGTGTGTGGAGGCCAGTAGG + Intronic
1006021567 6:31120818-31120840 GACTGCGAGTGGAGGGCAGATGG - Intronic
1006798314 6:36744519-36744541 GGCTGCGCCTGGAGGAGAGAGGG + Intronic
1007278515 6:40693088-40693110 GGCTGTGTGTGGGGGCGAGAGGG - Intergenic
1007496478 6:42263287-42263309 GGGTGAGTGTGGGGGAGAGAGGG + Intronic
1007561046 6:42808670-42808692 GGGTGTGTGTGGGGGAGAGATGG + Intronic
1008127162 6:47681749-47681771 GGCACTCTGTGGAGAACAGATGG + Exonic
1008520835 6:52361571-52361593 GGCTGTGGATTGAGGACACAGGG + Intronic
1010482840 6:76375442-76375464 GGCAGTGGGTGCAGGACAGTGGG - Intergenic
1010988997 6:82458461-82458483 GCCTGAGTGTGGAGCAGAGAGGG + Intergenic
1011756625 6:90505791-90505813 GGATGAGGGTGGAGGAGAGATGG + Intergenic
1013532414 6:111032275-111032297 GGCTGAGTTTGGAGGACTGCTGG - Intergenic
1013908845 6:115250199-115250221 GGCAGTGGGTGCAGGACAGTGGG + Intergenic
1014565717 6:122945400-122945422 GACTGTGGGTGCAGGACAGTGGG - Intergenic
1014723583 6:124949394-124949416 GGGTGTGTGTGGCGAAAAGATGG + Intergenic
1015050041 6:128829592-128829614 GACAGTGGGTGGAGGACAGTGGG + Intergenic
1015462346 6:133505839-133505861 AGCTGTATGTTGAGGAGAGAAGG - Intronic
1015534109 6:134249626-134249648 GGCTGTGTTTCCAGGACAGGGGG - Intronic
1015770251 6:136761402-136761424 AGGGCTGTGTGGAGGACAGAAGG + Intronic
1016652049 6:146473279-146473301 GACTGAGTGTAGAGTACAGAGGG + Intergenic
1017920792 6:158870224-158870246 AGTTGTGGGTGGGGGACAGAAGG + Intronic
1018015004 6:159704268-159704290 GACAGTGGGTGGAGGACAGTGGG + Intronic
1018755599 6:166846724-166846746 GGCTGTGTGTTTGGCACAGATGG - Intronic
1018798906 6:167207672-167207694 AGGTGTGGGTGGAGGACTGAAGG + Intergenic
1018851488 6:167643703-167643725 GGTTTTGTGAGGAGCACAGAAGG - Intergenic
1018915560 6:168130492-168130514 GGCTGAGTGTGGGGGGCACACGG + Intergenic
1018920324 6:168168013-168168035 GGCTGTGTGTGAGGGATAGGAGG + Intergenic
1019624846 7:2010891-2010913 GAGTGTGAGTGGGGGACAGAGGG + Intronic
1019807203 7:3136718-3136740 GGCTGTGTGGGGATGAGGGAGGG - Intergenic
1019862269 7:3670329-3670351 GGCTGTGGCTGGACGTCAGAGGG - Intronic
1020678032 7:11203355-11203377 GGCTGAGGCTGGAGGACAGCTGG + Intergenic
1020845353 7:13274686-13274708 GGCAGTGTGTGCAGGACAGTAGG - Intergenic
1021201393 7:17732002-17732024 GGGTCTGTGAGGAAGACAGAAGG - Intergenic
1022528107 7:31051353-31051375 GGCTGGGTGGGGTGGGCAGAGGG + Intergenic
1023497666 7:40815521-40815543 GCCTGAGTGTGGAGCAGAGAAGG + Intronic
1023863071 7:44227006-44227028 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1023863110 7:44227117-44227139 GAGGGAGTGTGGAGGACAGAGGG + Intronic
1023863197 7:44227376-44227398 GACGGAGTGTGGGGGACAGAGGG + Intronic
1023863314 7:44227709-44227731 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1023966288 7:44964728-44964750 GGGTGGGTGTGGATGACAGGAGG - Intronic
1024258447 7:47556949-47556971 GGCAGGGACTGGAGGACAGAGGG - Intronic
1024582329 7:50810017-50810039 GGGTGTGTGTGGGGGAGGGAGGG + Intergenic
1024635003 7:51280042-51280064 TGCTCTATGTGGAGGAGAGAGGG - Intronic
1024729505 7:52238812-52238834 GGAAGGGTGGGGAGGACAGAGGG - Intergenic
1025261984 7:57425850-57425872 GGCTCGGTGTGGGGGCCAGACGG - Intergenic
1026598832 7:71756402-71756424 GGCTGTGTGTCGGGGAAATAGGG - Intergenic
1026800699 7:73398024-73398046 GGCTGTGCGTGGAGCAGAGATGG - Intergenic
1027520379 7:79199251-79199273 GGCTGCATTTGGAGGGCAGAAGG + Intronic
1029866053 7:103630335-103630357 GGGTGTGTGTGGAAGACTGTTGG - Intronic
1030065399 7:105655439-105655461 GGGTGTGTGGGGTGGACAGGAGG + Intronic
1030096642 7:105906518-105906540 GCCAGTGTTTGGGGGACAGAAGG + Intronic
1030309601 7:108055952-108055974 GCCTGTGTCTGGATCACAGATGG + Exonic
1030647685 7:112081689-112081711 AGCTGTGTGTGGAGTATTGACGG - Intronic
1031144048 7:117978219-117978241 GGATGTGTGAGGGGGAGAGATGG - Intergenic
1031549020 7:123085326-123085348 GACAGTGTGTGCAGGACAGTGGG - Intergenic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1032823839 7:135550373-135550395 AGCAGTGTGTGGAGGAGAGTGGG - Intergenic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033426832 7:141252327-141252349 GGCTGTGCCTGCAGGACAGAGGG - Intronic
1033803024 7:144923133-144923155 GGGTGTGTGTGAACCACAGAAGG - Intergenic
1034161037 7:148994522-148994544 AGCTGGGTGTGAAGGTCAGAGGG - Intergenic
1034266050 7:149781144-149781166 GGCTGAGTGGTGATGACAGAGGG - Intergenic
1034316945 7:150141996-150142018 GGCTGGGGCTGGAGGACAGCAGG - Intergenic
1034431821 7:151044960-151044982 GGCTCTGTAAGGGGGACAGAGGG + Intronic
1034789919 7:153958690-153958712 GGCTGGGGCTGGAGGACAGCAGG + Intronic
1034822816 7:154232566-154232588 GGCTGTGTATGGAGAACCAATGG + Intronic
1034894428 7:154866883-154866905 GGCTTTGTGTGGAGAACATGGGG - Intronic
1035251165 7:157598187-157598209 CGCTGGGTGGGGAAGACAGAGGG - Intronic
1035296848 7:157872306-157872328 GGGTGTGTGGGGAGGACACTGGG - Intronic
1035399506 7:158555593-158555615 GGCTGGGTCTGGGGGACAGCTGG - Intronic
1035438602 7:158878214-158878236 TGCTGTGTGGGGAGGCCAGGAGG + Intronic
1035442750 7:158917366-158917388 GGTGGAGTGTGGAGGACAGGAGG - Intronic
1035442758 7:158917408-158917430 GGTGGAGTGTGGAGGACAGGAGG - Intronic
1035442767 7:158917450-158917472 GGTGGAGTGTGGAGGACAGGAGG - Intronic
1035442776 7:158917492-158917514 GGTGGAGTGTGGAGGACAGGAGG - Intronic
1035442784 7:158917534-158917556 GGTGGAGTGTGGAGGACAGGAGG - Intronic
1035442805 7:158917618-158917640 GGTGGAGTGTGGAGGACAGGAGG - Intronic
1036184496 8:6612321-6612343 GGCTGGCTGTGGAGGAGAGGAGG - Intronic
1036578541 8:10051867-10051889 GGCTGTGTGGGGAAGAGAAAGGG + Intergenic
1036615367 8:10383390-10383412 TTCTGTGTGTGAAGGAGAGACGG + Intronic
1036773880 8:11596844-11596866 GGCAGGGTGGGGAGTACAGATGG - Intergenic
1037952332 8:23027567-23027589 GGCTGACTGTGGGGGACACATGG - Intronic
1037963749 8:23117821-23117843 GGCTGACTGTGGGGGACACATGG + Intergenic
1037967301 8:23144902-23144924 GGCTGACTGTGGGGGACACACGG - Intronic
1038366513 8:26940938-26940960 GGCAGTGGGTGCAGGACAGTGGG - Intergenic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1040570522 8:48605389-48605411 GACTGTGAATGGAGGAGAGAAGG + Intergenic
1041320985 8:56612266-56612288 TGGTGAGTGTGGAGGACACAGGG + Intergenic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1042905429 8:73767316-73767338 GGCTATGTGTAGTGAACAGATGG + Intronic
1043130594 8:76456080-76456102 GACTGTGTGCGGAGGGCAGGGGG - Intergenic
1043762332 8:84082852-84082874 GACAGTGGGTGCAGGACAGAGGG - Intergenic
1044178722 8:89163000-89163022 GGCAGTGGGTGCAGGACAGTGGG + Intergenic
1044308585 8:90666282-90666304 GCCTGTGTATGGAGCAGAGAGGG + Intronic
1044690667 8:94874439-94874461 AGCTGTGTGTGGAGGAACGGGGG - Intronic
1045322383 8:101091803-101091825 GCCTCTGTGTCAAGGACAGATGG - Intergenic
1047930996 8:129728219-129728241 ACCTGAGTGTGGAGGAGAGAGGG - Intergenic
1048209678 8:132444268-132444290 GGCTGGGTGAGGAGGGCAGGAGG - Intronic
1048330235 8:133466089-133466111 CTCTGTGGGCGGAGGACAGAAGG + Exonic
1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG + Intronic
1049346752 8:142143366-142143388 GGCTGTGTTTTGAGGATGGAAGG - Intergenic
1049705685 8:144040937-144040959 GGCGTTGTGTGGAGGACAGTGGG - Exonic
1050197236 9:3099082-3099104 GGCATAGTGTGGAGGACTGATGG - Intergenic
1050533255 9:6608887-6608909 GGCTGTGTGTCCCTGACAGAAGG + Intronic
1051456946 9:17269037-17269059 GGCAGTGGGTGCAGGACAGTGGG - Intronic
1053345780 9:37377300-37377322 GTGTGTGTGTGTAGGAGAGAAGG + Intergenic
1053725133 9:40991907-40991929 GACTGTGTGTGCAGGAAACAAGG - Intergenic
1054157209 9:61649324-61649346 AGCTGGCTGTGGAGGAAAGATGG + Intergenic
1054476984 9:65580329-65580351 AGCTGGCTGTGGAGGAAAGATGG + Intergenic
1054681091 9:67919642-67919664 AGCGGTGTGTGGAAGGCAGAAGG + Intergenic
1056765153 9:89440506-89440528 GGCTGAGTGTGGAGGGCAAGCGG - Intronic
1057119622 9:92559403-92559425 GGGTGTGTGTTTAGGAGAGACGG + Intronic
1057272439 9:93658572-93658594 GTCTGTGGGTGGGGGACAGATGG + Intronic
1058237627 9:102512009-102512031 TGCAGAGTGTGGAGGAGAGAGGG - Intergenic
1058648323 9:107151638-107151660 GGCTGCCTCTGGAGGATAGATGG + Intergenic
1059700298 9:116769436-116769458 GGCTGTGAATGGAAGACATAAGG + Intronic
1059957600 9:119534478-119534500 GGCTCTGTAAGGAGGACAGTGGG - Intergenic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060403230 9:123360440-123360462 GGCGGGGTGTGGAGGGCAGCAGG - Intronic
1060966534 9:127715093-127715115 GGCTGGGTGTGGCGGAGAGTTGG - Exonic
1061609715 9:131738740-131738762 GGCTGTGGTTGAAGCACAGAAGG - Intronic
1061809908 9:133156183-133156205 GGCTGTGGGGGAAGGTCAGAGGG - Intronic
1061821465 9:133229163-133229185 CTCTGTGTGTGGAGCAGAGAGGG - Intergenic
1061833973 9:133317200-133317222 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG + Intergenic
1062139112 9:134945680-134945702 GGCAGAGGGTGGAGGGCAGAGGG + Intergenic
1062237781 9:135520901-135520923 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1062443654 9:136584434-136584456 GGCTGTGTGTGTGTGACAGTGGG - Intergenic
1062524819 9:136973915-136973937 GGCTGTCTGTGGGGGACAGATGG - Intergenic
1062635556 9:137488756-137488778 TGCTGTGGGTGGTGGACAGTTGG - Intronic
1062722123 9:138050093-138050115 GGCAGCGTGTGGGGGAGAGAAGG - Intronic
1185644010 X:1604212-1604234 AGCTGTGTGCGCAAGACAGAAGG + Intergenic
1186416908 X:9391777-9391799 GGCTGTGGGTGGAGGGCAACGGG + Intergenic
1186470735 X:9820313-9820335 GGCTGTGGCTGGAGCAAAGAGGG - Intronic
1187069673 X:15875676-15875698 AGCTGTGGAAGGAGGACAGAGGG + Intergenic
1187222170 X:17338693-17338715 AGCTGTGTGTGGAGCACAGGGGG + Intergenic
1188225477 X:27592243-27592265 GGCTGTGTGAGGATGCCAGATGG - Intronic
1189297701 X:39930363-39930385 CTCTGTGTGTGCTGGACAGATGG + Intergenic
1190181144 X:48193833-48193855 GGCTGTAAGTGGAGGAGGGAGGG - Intronic
1190194182 X:48303312-48303334 GGCTGTAAGTGGAGGAGGGAGGG - Intergenic
1190200056 X:48353705-48353727 GGCTGTAAGTGGAGGAGGGAGGG - Intronic
1190203845 X:48385720-48385742 GGCTGTAAGTGGAGGAGGGAGGG + Intronic
1190206691 X:48409683-48409705 GGCTGTAAGTGGAGGAGGGAGGG - Intronic
1190654564 X:52599532-52599554 GGCTGTAAGTGGAGGAGGGAGGG + Intergenic
1190655653 X:52610245-52610267 GGCTGTAAGTGGAGGAGGGAGGG - Intergenic
1190660695 X:52651955-52651977 GGCTGTAAGTGGAGGAGGGAGGG - Intronic
1190666852 X:52704198-52704220 GGCTGTAAGTGGAGGAGGGAGGG - Intronic
1190672566 X:52754210-52754232 GGCTGTAAGTGGAGGAGGGAGGG + Intronic
1190753157 X:53379845-53379867 GGGTGTGTGTGATGAACAGATGG + Exonic
1191044227 X:56119122-56119144 GCCTGTATGTGAAAGACAGAAGG + Intergenic
1191178581 X:57534812-57534834 GGCTGGGAGAGGTGGACAGATGG - Intergenic
1192554623 X:72079934-72079956 GGCTGTGGGTGGAGTGCAGCGGG + Intergenic
1192732899 X:73819017-73819039 GGCTGGATGTGTAGGACAGAGGG - Intergenic
1193758902 X:85441245-85441267 GGCTCTGTGTGGCGGACCCAAGG + Intergenic
1193779211 X:85682658-85682680 GCCTGGGTGTGGAGCAGAGAGGG + Intergenic
1193779759 X:85686841-85686863 GGGTGTGTGTGCAGGAGAGAAGG + Intergenic
1195472888 X:105252994-105253016 GGCAGGGTGTAGAAGACAGAAGG - Intronic
1195734821 X:108001242-108001264 GCCTGGGTGTGGAGTGCAGAGGG - Intergenic
1196613775 X:117743675-117743697 GCCTGGGTGTGGAGTCCAGAGGG - Intergenic
1196621903 X:117833443-117833465 GGCAGTGGGTGCAGGACAGTGGG - Intergenic
1196857826 X:120000278-120000300 GTGTGTGTGTGGCGGACGGAAGG + Intergenic
1196909155 X:120468606-120468628 GTGTGTGGGTGGGGGACAGATGG - Intronic
1197128864 X:122980402-122980424 GGCTGTGTATGGAGGAAAGGAGG - Intergenic
1197132279 X:123019525-123019547 GGTTGTGTGTTCAGGAGAGAAGG - Intergenic
1197708413 X:129649976-129649998 GGCAGTGTGTGGAGATGAGATGG + Intronic
1198330421 X:135617711-135617733 GTTTCTGTGTGGAGGAGAGATGG - Intergenic
1198336506 X:135671288-135671310 GTTTCTGTGTGGAGGAGAGATGG + Intergenic
1198968233 X:142250425-142250447 GCCTGTGTGTGGAGTGCAGAGGG + Intergenic
1199033098 X:143024028-143024050 GGTTGTGTTTGGAGGTCAGCAGG + Intergenic
1199879489 X:151961970-151961992 GGTTGTGTGTGGGGGATAGCAGG - Intronic
1199887668 X:152037440-152037462 GGCTGGTTGTTAAGGACAGAGGG - Intergenic
1200329463 X:155281206-155281228 GGCAGTGGGGGGAGGAAAGAGGG + Intronic
1200742450 Y:6868637-6868659 GTCTGTATGTGGAGTACACATGG + Intronic
1200871402 Y:8102432-8102454 GGCTGTGGGTGCAGGACAGTGGG - Intergenic
1201291061 Y:12421151-12421173 GCCTCAGTATGGAGGACAGACGG - Intergenic
1201782861 Y:17742683-17742705 GGCTGAGGGTGGAGGAAAGGTGG + Intergenic
1201795722 Y:17894682-17894704 GGCAGTGGGTGCAGGACAGTGGG + Intergenic
1201805833 Y:18011303-18011325 GGCAGTGGGTGCAGGACAGTGGG - Intergenic
1201818692 Y:18163304-18163326 GGCTGAGGGTGGAGGAAAGGTGG - Intergenic
1202357147 Y:24063774-24063796 GGCAGTGGGTGTAGGACAGTGGG + Intergenic
1202391504 Y:24375052-24375074 GGGTGTGTGTGGAGTGTAGAGGG - Intergenic
1202479281 Y:25295065-25295087 GGGTGTGTGTGGAGTGTAGAGGG + Intergenic
1202513630 Y:25606340-25606362 GGCAGTGGGTGTAGGACAGTGGG - Intergenic