ID: 1032154908

View in Genome Browser
Species Human (GRCh38)
Location 7:129459704-129459726
Sequence CTGCAGTCCTTTGGCCAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032154903_1032154908 8 Left 1032154903 7:129459673-129459695 CCAGACTCTTTCTGGACCTTCTG 0: 1
1: 0
2: 0
3: 16
4: 222
Right 1032154908 7:129459704-129459726 CTGCAGTCCTTTGGCCAAATAGG 0: 1
1: 0
2: 1
3: 7
4: 117
1032154904_1032154908 -8 Left 1032154904 7:129459689-129459711 CCTTCTGCATTCCTCCTGCAGTC 0: 1
1: 0
2: 1
3: 47
4: 339
Right 1032154908 7:129459704-129459726 CTGCAGTCCTTTGGCCAAATAGG 0: 1
1: 0
2: 1
3: 7
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032154908 Original CRISPR CTGCAGTCCTTTGGCCAAAT AGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
902977152 1:20097204-20097226 CTGCAGTCCCGTGTCCCAATTGG - Intergenic
906256620 1:44355333-44355355 CTGCAGCCCATTGGTCAAAGGGG - Intergenic
906994859 1:50781166-50781188 CTGCACCTCTTTGGCCAACTAGG + Intronic
911042696 1:93603619-93603641 CTGCAGAACTTTAGCCAAAAGGG - Intronic
911170503 1:94766475-94766497 GTACAGTCATTTGCCCAAATTGG - Intergenic
913194511 1:116444573-116444595 CGGCTGTGCATTGGCCAAATGGG - Intergenic
913505545 1:119513401-119513423 TTCCAGTCCTTAGGCAAAATGGG - Intronic
915140996 1:153768486-153768508 GTGCTGACCTTTGGCCAAAGAGG - Intronic
922917471 1:229270791-229270813 AAGCAGTCCATTTGCCAAATTGG - Intergenic
923748701 1:236726930-236726952 CTGAAGTACTTGGGCCAACTAGG - Intronic
1064404559 10:15049716-15049738 CTCCACTCATTTTGCCAAATGGG + Exonic
1072210361 10:93240569-93240591 CTGCTGTCCTTTGATCAAGTGGG + Intergenic
1072901184 10:99408375-99408397 CTTCAATCCTTTAGACAAATTGG - Intronic
1074052398 10:109892117-109892139 CTGTAGACCTATGGCCAAAGTGG + Intronic
1074093454 10:110285699-110285721 CTGCTGCCCTTAGGCCACATGGG + Exonic
1077925828 11:6681453-6681475 CTCCACCCCTTTGGCCAAACTGG + Exonic
1078349957 11:10584470-10584492 CTCCAGTCGTTTGGATAAATAGG - Intronic
1079639034 11:22781147-22781169 CTGCTGTCCTTTGGCAAACAAGG + Intronic
1080868035 11:36212900-36212922 CTGCCATCCTTTGGGCAAATGGG - Intronic
1081184539 11:40025979-40026001 CAGAAATCCTTTGGCAAAATAGG + Intergenic
1083492771 11:63025182-63025204 CTCCAGGCCTTTGGCCTCATTGG + Intergenic
1091228303 11:133971464-133971486 CTGCAGGCCTGTGGGCAGATGGG - Intergenic
1091433759 12:458097-458119 CTGCAGTTCTTTAGCAAAAAGGG - Intergenic
1091636844 12:2203573-2203595 CTGCAGTCCTATGGCCAAGCCGG + Intronic
1093226147 12:16486085-16486107 ATTCAGGCCTTTGCCCAAATGGG + Intronic
1094069794 12:26400761-26400783 CTGCAGTCCTTTTGCCTCCTGGG - Intronic
1104162921 12:126198007-126198029 CAGCAGTTCCTTGGCCAAAAGGG + Intergenic
1108268945 13:48739605-48739627 GTGCCGTGGTTTGGCCAAATAGG - Intergenic
1110134509 13:72048773-72048795 CTGTCATCCTTTGGCTAAATGGG - Intergenic
1111941613 13:94614337-94614359 CTGTAGTCCTTTGGCTCAAAAGG + Intronic
1112422587 13:99266447-99266469 CTGCAGCCCATGGGCCACATGGG - Intronic
1113634391 13:111909865-111909887 CTCTAGTCCTTTTGGCAAATGGG + Intergenic
1114049559 14:18912312-18912334 CTGCACTGCTTTGGGCAAGTGGG - Intergenic
1114113003 14:19489619-19489641 CTGCACTGCTTTGGGCAAGTGGG + Intergenic
1116257041 14:42570411-42570433 CTTCAGTCCTTTGGCAAATTTGG + Intergenic
1116546250 14:46168515-46168537 CTGCAGTCTTTTGGCCAGCCTGG - Intergenic
1119076433 14:71644579-71644601 CAGCAGTCATTTGGAAAAATTGG + Intronic
1121479278 14:94248760-94248782 GTGCATTCCTTTGTCCACATTGG + Intronic
1122910046 14:104823143-104823165 CTGCAGTCCTTTGCACAAAGTGG - Intergenic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1127139460 15:55960123-55960145 CTGCAGTCCTTTGGGGGTATGGG - Intronic
1130915401 15:88300676-88300698 CTGAAGTCATTTGGCCCAAATGG + Intergenic
1131293921 15:91130710-91130732 CTGCAGTCCTGGGGGCAAAGAGG + Intronic
1131966326 15:97847940-97847962 ATGCACACCTCTGGCCAAATAGG + Intergenic
1132423772 15:101696655-101696677 CTGGGGTCCTTTGGCCAAGAGGG - Intronic
1134297276 16:12958111-12958133 CTACACTCTTTTGCCCAAATGGG + Intronic
1139653940 16:68376317-68376339 CTGCGCTCCTTTGGCCTAGTTGG + Intronic
1140802169 16:78498548-78498570 CTGCACACCTTTGGCCTAAAGGG + Intronic
1142129413 16:88425911-88425933 CTGGAGACCTTGGCCCAAATTGG + Intergenic
1143086804 17:4422167-4422189 CTGCATTCCATTGGCCACACAGG - Intergenic
1146896439 17:36545189-36545211 CTGCAGTCCTGGGGCCGACTGGG + Intronic
1148558879 17:48594658-48594680 CTGCAGTCTTTTCGGCAACTAGG - Intronic
1150347034 17:64412159-64412181 CTGCAGTTCTTGGGCCACGTAGG + Intronic
1151196538 17:72435660-72435682 CTGTAGGCATTTGGCAAAATGGG - Intergenic
1153267553 18:3285973-3285995 CTGCAGCACTTCGGCCAAAAAGG + Intergenic
1156232953 18:35172806-35172828 CTGAAGTCCCTTTGCCAAAAAGG + Intergenic
1163249109 19:16115662-16115684 CTGCAGCCCTCTTGCCAAAATGG - Intronic
925710663 2:6736579-6736601 CTGCATGCCTTTGAACAAATCGG - Intergenic
931056741 2:58480864-58480886 CTGCAGTGCTTTGGGCAATGTGG + Intergenic
931694634 2:64862500-64862522 CTACATTCCATTGGCCAAAAGGG - Intergenic
932617573 2:73244216-73244238 CTGACTTCCTGTGGCCAAATTGG + Intronic
936576997 2:113665596-113665618 CTGAAATGCTTTGGCCACATAGG - Intergenic
937238718 2:120446651-120446673 ATGCATTTCTTGGGCCAAATGGG + Intergenic
937373628 2:121320063-121320085 CTGCAGTCCATTTGTCAAATGGG + Intergenic
938211568 2:129469847-129469869 CTGCAATCCTCTACCCAAATTGG - Intergenic
941466476 2:165833419-165833441 TTGAAATCCATTGGCCAAATTGG - Intergenic
945083449 2:206108761-206108783 CTGCATTCCCTTGGGAAAATGGG - Intergenic
946498960 2:220225364-220225386 CTGTATGCCTTTGGGCAAATTGG - Intergenic
1169432138 20:5546005-5546027 CTGCAGACCTTTGTCCAATACGG - Exonic
1172886046 20:38231395-38231417 CTGCAGACCTTTGGCCGTAACGG + Intronic
1173456908 20:43210087-43210109 CTGCTGTACTTTGGCCACAGTGG - Intergenic
1173756166 20:45518398-45518420 CTGTACTCGTTTGGCCAAACAGG + Intergenic
1177649339 21:23940375-23940397 CTGCAGCCCTTTGGCTACAGAGG + Intergenic
1178495202 21:33080465-33080487 CTGCACACCCTTGGCCAGATGGG + Intergenic
1178901924 21:36605468-36605490 CTGCTGTCCTGTGAGCAAATGGG - Intergenic
1179931804 21:44575534-44575556 TTGCAGCCCTTTGGCCATTTCGG + Intronic
1180468038 22:15634687-15634709 CTGCACTGCTTTGGGCAAGTGGG - Intergenic
1181093785 22:20492422-20492444 CAGCAGTCCTTAGTCCAAAAGGG + Intronic
1183597563 22:38821896-38821918 CTGCAGCCCTTTGGCCTCCTGGG + Exonic
1185423244 22:50747077-50747099 CTGAAATGCTTTGGCCACATAGG + Intergenic
952147244 3:30547150-30547172 CTGCAGTGCCTTGGCCAAGAGGG - Intergenic
952498501 3:33936876-33936898 CTGCAGCCATTTGGGCAAAGGGG - Intergenic
952847564 3:37701144-37701166 GAGCAGTCCTTTGTCCACATGGG + Intronic
955121552 3:56064798-56064820 CTGCAGCCCATGGGCCAAACTGG + Intronic
955836538 3:63061585-63061607 CTGCTGTCCCTTTGCCAAAGAGG + Intergenic
957081597 3:75641071-75641093 CTGCAGCCCTGTGACCAAAGAGG - Intergenic
958984635 3:100766299-100766321 CTACAGTGCTTTCCCCAAATGGG - Intronic
959216058 3:103451552-103451574 TTGAATTCCTTTGGCCACATTGG + Intergenic
969366587 4:6698506-6698528 CTGCAGTCCCTTCCCCAAAGAGG - Intergenic
969507280 4:7595917-7595939 CTGCAGTCCCCTGGCCCCATGGG + Intronic
971543400 4:27851690-27851712 CTGCATTCCATTGGCAAAACGGG + Intergenic
973839733 4:54849066-54849088 CTGCTCTCCTTTGGATAAATAGG + Intergenic
975427799 4:74250912-74250934 CTGGAGTTCTGTGGCAAAATGGG + Intronic
975835919 4:78422077-78422099 CTGCAGTCCTCTGGACCATTTGG + Intronic
976336453 4:83893656-83893678 CTGTAGTCTTTTTGCCAAATTGG - Intergenic
986452553 5:7880940-7880962 CTGCAGTCCTTCTCCCAAAGGGG - Intronic
992706436 5:79399195-79399217 TTGCAGTCTTTTGCCCAATTTGG - Intronic
995837261 5:116411181-116411203 TTGCAGTCCTGTTGCCAAACGGG + Intronic
997774945 5:136594973-136594995 CTGCCTTCTTTTGGACAAATCGG + Intergenic
998188123 5:139998505-139998527 CTGCAGTCCCATGGCTAGATTGG - Intronic
999819393 5:155210423-155210445 CTGCGGTCCCTTGGCCAAGAGGG + Intergenic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1006063268 6:31441802-31441824 CTTCAGTCCTGTGGCCACACGGG - Intergenic
1014264464 6:119260233-119260255 CTACAGCCCTTTGGCCAAATTGG - Intronic
1021828175 7:24574192-24574214 CTCCAGTTGTTTGGCCAAAGTGG + Intronic
1023885433 7:44350490-44350512 CCCCAGTCCTTTGGCCAGAGAGG - Intergenic
1026509790 7:71018444-71018466 CTGCAGTCCTATGGCAATACAGG + Intergenic
1029287860 7:99478618-99478640 CTGCAGCCCTCTGGGCAAAGGGG - Intronic
1032154908 7:129459704-129459726 CTGCAGTCCTTTGGCCAAATAGG + Intronic
1032272439 7:130422487-130422509 CTGCAGCCCTTTAGCCAACAGGG - Intronic
1034440868 7:151085612-151085634 CTGCAGTCCCATTGCCAAAGTGG - Intergenic
1034855034 7:154536766-154536788 CTGCAGTCATTGGGTCACATGGG - Intronic
1041500977 8:58538457-58538479 CTGCTGCCCTTTGTCCACATGGG + Intergenic
1042650676 8:71037359-71037381 CTGCAGTCCTTTGACCTATTTGG - Intergenic
1046628281 8:116598382-116598404 CTGCATTACTTTGGCCAAGCAGG - Intergenic
1046705566 8:117447199-117447221 CTCTAGTTCTTTTGCCAAATGGG + Intergenic
1047139967 8:122127118-122127140 GTGCAGTCCTCTGACCATATTGG - Intergenic
1047909091 8:129507319-129507341 CTTCCGACTTTTGGCCAAATGGG - Intergenic
1049033189 8:140052255-140052277 CTGCAGTCCTTTCTCTTAATTGG + Intronic
1061361215 9:130143457-130143479 CAGCATTCCTTTGGCAAACTGGG - Intergenic
1185523232 X:757363-757385 CTACAGTGTTGTGGCCAAATTGG - Intergenic
1187100721 X:16188395-16188417 CTACAGTGCTTTGGCCACAAAGG - Intergenic
1189425627 X:40897378-40897400 CTGCAGTTCTTTGTCCAGGTTGG - Intergenic
1192374578 X:70546781-70546803 CTGCAGTCTGTTTGCCAAAGTGG - Intronic
1195870373 X:109479365-109479387 GTGCAGTCCTCTTTCCAAATAGG - Intronic