ID: 1032155377

View in Genome Browser
Species Human (GRCh38)
Location 7:129463469-129463491
Sequence TTTTCAAAGGGGAAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 452}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032155377_1032155383 27 Left 1032155377 7:129463469-129463491 CCTTCCATCTTCCCCTTTGAAAA 0: 1
1: 0
2: 3
3: 37
4: 452
Right 1032155383 7:129463519-129463541 GGAGTCTCACTCTGTCGCCCAGG 0: 7932
1: 55019
2: 107113
3: 150256
4: 160143
1032155377_1032155382 6 Left 1032155377 7:129463469-129463491 CCTTCCATCTTCCCCTTTGAAAA 0: 1
1: 0
2: 3
3: 37
4: 452
Right 1032155382 7:129463498-129463520 TCTTTTTTTTTTTTTTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032155377 Original CRISPR TTTTCAAAGGGGAAGATGGA AGG (reversed) Intronic
900337940 1:2174071-2174093 TTTTCAAAGGTGCAGGTGGAGGG + Intronic
902665522 1:17935059-17935081 TTTTAAAAAGGGAAGTGGGAGGG - Intergenic
903614933 1:24644461-24644483 TTTTCAAAGGAAAAATTGGAAGG + Intronic
904087196 1:27917146-27917168 TTTTTAAAGAGGAAGGAGGAAGG - Intergenic
904363165 1:29991624-29991646 TTTTCCCAGAGGAAGAGGGAAGG + Intergenic
904590186 1:31609528-31609550 TTTTAAAAGGGGTGCATGGAAGG - Intergenic
904593090 1:31626196-31626218 TTCTCAAGGGGGAGGAGGGAAGG - Intronic
904654685 1:32035566-32035588 TGTTCTAAGTGGAAAATGGAGGG - Intronic
904839402 1:33362375-33362397 TTTCCAGAGAGGAAGATGCATGG + Intronic
905879682 1:41455504-41455526 TATTCCAGGGGGAAGATGGGAGG - Intergenic
906460507 1:46032448-46032470 TCCACAAAGGGGAAGCTGGAAGG - Intronic
906474321 1:46157831-46157853 CTTTCAGAAGGGAAGATAGAAGG - Intronic
906837572 1:49100444-49100466 TCTTCAAAGGAGAATCTGGATGG + Intronic
907400926 1:54224278-54224300 TGTTCCAAGGTGAAGAGGGAAGG + Intronic
908426581 1:64013687-64013709 TGGTCAAAGGGGTTGATGGAAGG - Intronic
912112232 1:106357659-106357681 TTTTAAAAGGGGCACATGGCCGG + Intergenic
912554999 1:110509303-110509325 TCTTGAAAGGGGAATAGGGATGG + Intergenic
913187609 1:116383660-116383682 CTTTCAGTAGGGAAGATGGAAGG + Intronic
917958998 1:180127773-180127795 TTAGCAAAGGGGAAGATGGCAGG + Intergenic
918209691 1:182339888-182339910 CTTCCAAAGAGGAAGATGTATGG - Intergenic
919491843 1:198213722-198213744 CTTTCAAGGGGAAAGAAGGAAGG - Intronic
919835924 1:201573365-201573387 TTTTCAAGGGGAAAGAAGAAAGG + Intergenic
920495239 1:206450030-206450052 TTTTCAAAGGGGAAGCAGGGTGG - Intronic
920712467 1:208308365-208308387 TTTCCAAAGTGGAAGATACAGGG + Intergenic
920784450 1:209027429-209027451 TTTTTGAAGGGGAAGGTGGGGGG + Intergenic
921955767 1:220981896-220981918 TTTACAAAGGGCAAGAAGAAAGG - Intergenic
924286286 1:242490900-242490922 TTTACAAAGAGGAAGCAGGAAGG - Intronic
1063027465 10:2194611-2194633 TTTTCCAAGGGAATGATGGTAGG - Intergenic
1063589451 10:7381841-7381863 TTTCCAAGGGTGAAGATGAAGGG + Exonic
1064349904 10:14567299-14567321 TTTGCAAAGGGGCAGTGGGAAGG + Intronic
1064507104 10:16044122-16044144 TCTTTAAAGTGGAAGATGCAGGG + Intergenic
1064585050 10:16831761-16831783 TTTTAAAAGGTGGAGATGGGCGG + Intronic
1064826115 10:19403084-19403106 TTTACAAAGTGGAAGATTTAGGG + Intronic
1064863115 10:19848810-19848832 TTTTGGAAGGGGAGGATGGCAGG + Intronic
1064934846 10:20668199-20668221 TTTTCAAAGAGTAAGTAGGATGG + Intergenic
1066073149 10:31841922-31841944 TTTGCAAAGGGTAAGGTAGAGGG + Intronic
1066514661 10:36144424-36144446 TTTTGAAAGTGGAAAATTGAAGG + Intergenic
1067018506 10:42775335-42775357 CTTTCCAAGAGGAAGAGGGAAGG + Intergenic
1067214564 10:44291890-44291912 TTTTCAGAGAGGAGGGTGGAAGG - Intergenic
1067809530 10:49416572-49416594 TCTTCAAAGGGGAAAATGATTGG + Intergenic
1068698949 10:59999869-59999891 TTTGCAAAGTGGAAGAAGGAGGG - Intergenic
1069643554 10:69973520-69973542 TGGTCTCAGGGGAAGATGGAGGG - Intergenic
1069774040 10:70916581-70916603 TTTACAGATGGGAACATGGAGGG + Intergenic
1069925548 10:71848098-71848120 TTTACAAATGGGATCATGGAGGG - Intronic
1070071575 10:73095886-73095908 GTTTCAATGGGGAGGAAGGATGG - Intronic
1070481244 10:76884739-76884761 TTTAGAAAGTGGAAGAAGGAAGG + Intronic
1070584021 10:77747602-77747624 CTTTCAAAGGAGAAGATAAATGG - Intergenic
1071370532 10:84946745-84946767 TTTTAATAGAGGAAGAGGGAGGG - Intergenic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1072961661 10:99934750-99934772 ATTTCAAAGGGTGAGATGGTGGG + Intronic
1072964667 10:99961606-99961628 ATTTCAAAGGGTGAGATGGTGGG - Intronic
1073537741 10:104292967-104292989 TTTTCAGAGGGGTAAATGCAAGG + Intronic
1073730633 10:106283189-106283211 ATCTCAAGGGGGAAGATGGGAGG + Intergenic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1074416322 10:113270015-113270037 TTTTAAAAAAGGAAGTTGGAAGG + Intergenic
1074676848 10:115860939-115860961 TCTTCAAAGGCCCAGATGGAAGG - Intronic
1074937647 10:118201683-118201705 TTTTCAAAGAGCAGGAGGGATGG - Intergenic
1075856594 10:125635283-125635305 TTTTCAAAGTGCTAGATGCAGGG - Intronic
1075931488 10:126300397-126300419 TTTGGTAAGGGGAAGAAGGAAGG - Intronic
1076437966 10:130459518-130459540 TTTTCCAAGGTGAAGAGTGAGGG + Intergenic
1076511314 10:131015689-131015711 CTCACAAAGGGGAAGCTGGAGGG + Intergenic
1076866316 10:133168047-133168069 GTTCCAAAGTGGAAGAGGGAAGG - Intronic
1077616115 11:3675300-3675322 TTCTGGAAGGGGTAGATGGAGGG + Exonic
1077912224 11:6582076-6582098 TTCACAAAAAGGAAGATGGATGG + Intronic
1079502586 11:21118284-21118306 TTTACAATGGGGAATATGGATGG + Intronic
1079885637 11:25985151-25985173 TTTTCAGAGAGGAAGCAGGAGGG + Intergenic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1081443811 11:43109938-43109960 TTATGAAAGGGGAAAATGTATGG + Intergenic
1082989773 11:59197365-59197387 GTATCAAAGGGCAAGAAGGAAGG + Intronic
1083608574 11:63993850-63993872 GTTTCAAAGAGGAAGCTGGCCGG + Intronic
1085179829 11:74524457-74524479 TTTTCACAGGTGAAGCTGGCAGG - Intronic
1086296977 11:85380259-85380281 TTTTGAAAAGGGAATATTGAGGG - Intronic
1086372274 11:86166838-86166860 TTTTCAAAAAGGAAGAAGGTTGG + Intergenic
1086558661 11:88141817-88141839 TTTCCAAAGGCAGAGATGGAAGG - Intronic
1087373504 11:97315323-97315345 TTTCCAATGGGGAAAATTGATGG - Intergenic
1087856994 11:103104077-103104099 TTTCCAGAGCAGAAGATGGATGG + Intergenic
1088588012 11:111377072-111377094 TTTTTAAAGGGGATGCTGGAGGG - Intronic
1088844444 11:113652946-113652968 TCTTCAAAGGGGAAGATTGCGGG - Intergenic
1088892362 11:114055229-114055251 TTTTCAAAAGGGTAGGAGGAGGG - Intergenic
1089074992 11:115731016-115731038 TGGCCAAGGGGGAAGATGGAGGG + Intergenic
1089677601 11:120100167-120100189 TTCCCAAGTGGGAAGATGGATGG - Intergenic
1089775836 11:120835153-120835175 TGTTCCAATGGGAAGCTGGAGGG - Intronic
1089807178 11:121101121-121101143 TTTTCAAAGGGGAAAAAAAAAGG + Intergenic
1090445189 11:126758594-126758616 TTTTCAAGGTAGAAGATAGATGG + Intronic
1091226799 11:133962005-133962027 TTTGGAGAGGGCAAGATGGATGG - Intergenic
1091873152 12:3911984-3912006 GTGTCAAAGGGGAAGAGAGACGG - Intergenic
1091911181 12:4231848-4231870 TTTTCATAGGGAGAGATGGATGG - Intergenic
1092037296 12:5347773-5347795 TGTTCAAATGAGAAGATGCATGG - Intergenic
1092187335 12:6490521-6490543 TTTTCAGAGGGGTGGCTGGAAGG - Intergenic
1093099595 12:15011639-15011661 TTTTCAAAATGGAAGGTTGAGGG - Intergenic
1094080442 12:26528856-26528878 GTTGTAAAGGGGAAGATGAAAGG - Intronic
1094153731 12:27314841-27314863 TTTTAAAAGTAGAAAATGGAGGG - Intronic
1094731354 12:33179867-33179889 TTTGCACAGGGGAAGGGGGAGGG - Intergenic
1095139679 12:38646081-38646103 TTTTGACAGGGGAAGACAGAAGG + Intergenic
1095427163 12:42088731-42088753 TTTTCAATTAGAAAGATGGATGG + Intronic
1095473670 12:42563942-42563964 TTTTCATAGTGGGAGAAGGATGG - Intronic
1095528064 12:43151951-43151973 TTTTCAAAGGGGATTATTCATGG + Intergenic
1098599559 12:72314729-72314751 TTTTAAAAAGTGAAGATGAATGG + Intronic
1098682871 12:73380145-73380167 TTTCCAAAGGGGTACATCGATGG + Intergenic
1098725654 12:73963076-73963098 TTTTCACAGGGGCTGATGCAAGG + Intergenic
1099449433 12:82790884-82790906 TTTTTAAAGGGAAAGAGGCAGGG - Intronic
1099830320 12:87833936-87833958 TTTTAAAAGGGTAATATAGAAGG + Intergenic
1100356223 12:93833258-93833280 TTTGCAGATGGGAAGATAGATGG + Intronic
1100406400 12:94276228-94276250 TTTCTAAAGGGAAAGATGAATGG - Intronic
1100897550 12:99201072-99201094 TGTTCAAAGGGCAATAAGGAGGG + Intronic
1101687382 12:107038452-107038474 TTCTCAGAAGGAAAGATGGATGG + Intronic
1102693820 12:114782477-114782499 TATTCAAAGGGAAAGAAGGTGGG - Intergenic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1105825671 13:24120373-24120395 TTTTCTTTGGGGAAGATGTATGG + Intronic
1106245414 13:27945445-27945467 ATTTCCAAGGTGAAGATGTATGG + Exonic
1107328735 13:39273941-39273963 TTCTGAAAGGGGAAGAATGAAGG + Intergenic
1108046001 13:46385862-46385884 TTTACAAAGTGGGAGATGGTAGG - Intronic
1108984920 13:56574869-56574891 TTTACACAGTGGAAGGTGGAGGG + Intergenic
1110594874 13:77309116-77309138 TGTTTAAAGGGCAAGAAGGAAGG - Intronic
1110915366 13:81014342-81014364 TTTTGAAAATAGAAGATGGATGG + Intergenic
1111473278 13:88714085-88714107 TTTAAAAAGGAAAAGATGGAGGG + Intergenic
1111658909 13:91184807-91184829 TTTTTAAGGGGGAAGTGGGATGG - Intergenic
1111742576 13:92222246-92222268 GTTAAAAAGGGGAAGATGGGAGG + Intronic
1112159961 13:96856771-96856793 ATTTCAGAGTGGAAGATGGAGGG - Intergenic
1112379508 13:98875384-98875406 TTTTGAAAGTGAAAGAAGGAGGG - Intronic
1114893584 14:26957459-26957481 TTTACCAAGGGGAAGGTGGTGGG + Intergenic
1115029058 14:28773448-28773470 TTTTCAGAGGGGAAGGGGTAGGG + Intronic
1116045357 14:39736161-39736183 TTTTCAAAGGGGATGTTGCTAGG + Intergenic
1117933584 14:60874993-60875015 TTTTCCGAGGGAAAGATAGATGG + Intronic
1119416051 14:74470160-74470182 TTTTAAAAAGGGAAGGTAGAAGG - Intergenic
1119909391 14:78335946-78335968 TTTTAAAATGGAAAGCTGGAAGG - Intronic
1120108348 14:80522543-80522565 TCTTTCAAGGGGAAGAAGGATGG + Intronic
1120346503 14:83297130-83297152 TTTTTAAATGTGAAGATGAAAGG + Intergenic
1120582154 14:86265759-86265781 TTCTCAAAGGTGAAAATGAAAGG - Intergenic
1121409380 14:93738624-93738646 TTCCCAAAGGGTAATATGGATGG + Intronic
1121489032 14:94344645-94344667 TTTACAAATGAGAAAATGGAGGG + Intergenic
1122398434 14:101451633-101451655 TTATAAAAGGGGAAGAGGGTCGG - Intergenic
1124406162 15:29393929-29393951 TTTTTCCAGGGGAAAATGGAGGG - Intronic
1124498220 15:30201177-30201199 TTTTGTGAGGGGAAGATGAAAGG - Intergenic
1124745363 15:32337497-32337519 TTTTGTGAGGGGAAGATGAAAGG + Intergenic
1124808997 15:32915493-32915515 TTTTCAAAGTATAAAATGGAGGG - Intronic
1126222343 15:46228993-46229015 GATGCAAAGGGGAAAATGGAAGG - Intergenic
1126839839 15:52707016-52707038 TTTTGAAAGGGGGAGTTGTATGG + Intronic
1127229666 15:56976123-56976145 TTTTTAAAGTGGAAAATGGAAGG + Intronic
1127370197 15:58332004-58332026 TTTTGAAAGTGGAAGAGGGCAGG + Intronic
1128325624 15:66722300-66722322 GTTTCAAAGGGAAAGCAGGAGGG + Intronic
1128767046 15:70257666-70257688 TTTGAAAAGAGGAAGATGGAAGG - Intergenic
1129087382 15:73109470-73109492 TTTGCAGGGAGGAAGATGGAGGG + Intronic
1130821925 15:87505078-87505100 GCTTCATAGGTGAAGATGGATGG + Intergenic
1131212855 15:90512380-90512402 TTTCTAAAGGGTAAGAGGGAGGG - Intergenic
1131972330 15:97904898-97904920 TTTATAAATGGGAAAATGGACGG + Intergenic
1131985282 15:98037376-98037398 TTTTTAAAGTGGATGATGGAAGG - Intergenic
1135269140 16:21053864-21053886 TTTTTAAAGGAGGAGCTGGAAGG + Intronic
1135633367 16:24053673-24053695 CTTTCAAAGGAGATGAAGGAGGG + Intronic
1135718900 16:24797481-24797503 TTTACAAAGGGAATGATGAAAGG + Exonic
1136266080 16:29119567-29119589 TTTTGGAAGGCCAAGATGGAAGG + Intergenic
1136408245 16:30061858-30061880 TTTACAAAAGAGAAAATGGATGG - Intronic
1138458321 16:57133652-57133674 TTTTCAATGAGGAGGGTGGAGGG - Intronic
1138741032 16:59310396-59310418 CTTTTAAAGTGGAAAATGGAGGG + Intergenic
1138934831 16:61706292-61706314 ATTTCAAAGGGGAAGCGAGAGGG + Intronic
1138937810 16:61751366-61751388 TTTTTTAAGGAGAATATGGAAGG - Intronic
1139018792 16:62723204-62723226 ATTTCATAGTGGAAGATGGAAGG + Intergenic
1139180729 16:64745310-64745332 TTTTCAAATAGGAAGATGGAGGG - Intergenic
1139972355 16:70784000-70784022 TATTCAAGGGAGAACATGGAGGG + Intronic
1140451296 16:75072882-75072904 ATCTCAGAGGGGAAGCTGGAGGG - Intronic
1140920490 16:79533231-79533253 TTTTAAAGGGGGCAGAGGGATGG + Intergenic
1141019358 16:80480345-80480367 TCATTAAAGGGGTAGATGGAAGG - Intergenic
1142018839 16:87767184-87767206 ATTTTAAATGGGAAGGTGGAAGG - Intergenic
1145075320 17:19850089-19850111 TTTACAATGGGGAAAAAGGAAGG + Intronic
1145281906 17:21474269-21474291 TTTTCAAAAGAAATGATGGATGG - Intergenic
1145972948 17:28967672-28967694 AACTCAAAGGGGAAGATGTAAGG - Intronic
1146570828 17:33951082-33951104 TTTACAATGGAGAAAATGGATGG - Intronic
1146641335 17:34543958-34543980 ATTCCAAAGGGGCAAATGGAAGG - Intergenic
1146957502 17:36944636-36944658 TTTTCAAAGGGGAACCCTGATGG + Intergenic
1148217639 17:45842042-45842064 ATTTCAAAGGGGAGGTTGGCAGG - Intergenic
1148286054 17:46392903-46392925 TTTTGAAAGGGGAAGAAAAAGGG - Intergenic
1148308221 17:46610493-46610515 TTTTGAAAGGGGAAGAAAAAGGG - Intronic
1148388321 17:47252713-47252735 TTTTCCAAGTGGAAAAAGGAAGG + Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149591143 17:57830848-57830870 TTTTCAGATGGGAAAAGGGAAGG - Intergenic
1149868089 17:60161681-60161703 GTTACAAAAGGGAAGACGGAGGG - Intronic
1150740214 17:67773293-67773315 TTTTGAAAGGGGCTCATGGAGGG + Intergenic
1151833364 17:76568840-76568862 TATTGCAAGGGGGAGATGGAGGG + Intronic
1152978170 18:244772-244794 TTTCCAAAGAAGAAAATGGAGGG - Intronic
1152996707 18:414217-414239 TTTTCAAATGGGAAGCTTCAGGG + Intronic
1153729575 18:7996222-7996244 TTATCCCAGGGGAAAATGGATGG + Intronic
1153883867 18:9445868-9445890 TTTTAAAAGGAGAACATGGCAGG + Intergenic
1153929129 18:9863258-9863280 TTTTCAAAGAGGAAGGGGAATGG + Intergenic
1154333355 18:13447730-13447752 TTCGCAAAGGGAAAGAGGGATGG + Intronic
1154334240 18:13453146-13453168 TTTTCAAAGGGCAAGATACCGGG - Intronic
1155937364 18:31767707-31767729 TTTTTACATGGAAAGATGGAGGG - Intergenic
1156012860 18:32514037-32514059 TTTCCAAAGGGGAAGAAGCAGGG - Intergenic
1156205556 18:34882296-34882318 TTTTGAAAAGGGAGGGTGGAAGG - Intronic
1156365998 18:36427753-36427775 TTATGAAATGGGTAGATGGATGG + Intronic
1156883519 18:42108208-42108230 TTTTCAAAGGGAAGAAGGGAAGG - Intergenic
1156945183 18:42821027-42821049 TATTCATGGGGGAAGATGAAGGG - Intronic
1157668607 18:49509776-49509798 TTTACAAGAGGAAAGATGGAAGG - Intergenic
1157827926 18:50829641-50829663 TTTTCCAAGGGGTAGAAGAATGG - Intergenic
1158167719 18:54559206-54559228 TTTTTAATGGGGAAGAGGTAAGG - Intergenic
1158622185 18:59042480-59042502 TTTTCAAAGGAAAATCTGGAAGG + Intergenic
1158705007 18:59784424-59784446 GTTTTAAAGGGGAAAGTGGATGG + Intergenic
1159067452 18:63585966-63585988 TTTCCAAAGGGGAGCATTGAAGG + Intergenic
1159317014 18:66788525-66788547 TTTTAAAAGGGGAATGAGGAAGG - Intergenic
1162208499 19:9073809-9073831 TTTTCAAAGGGAAGGAAGGAAGG - Intergenic
1162695448 19:12470203-12470225 TTTTCAAAGGCCAAGATTTAGGG - Intronic
1162911239 19:13848926-13848948 TTTTCCAAGTGGAAGGTAGAGGG - Intergenic
1163365227 19:16872331-16872353 ATTTGAAGGGGGCAGATGGATGG + Intronic
1163489376 19:17607851-17607873 TGTTCACGGGGGTAGATGGATGG - Intronic
1163711378 19:18849258-18849280 TTTCCAGAGGGGAAGAGAGAGGG + Intronic
1164769743 19:30799395-30799417 TTTCCAAAGGGGAGGTTGCACGG + Intergenic
1166413682 19:42576187-42576209 TTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1166612715 19:44213192-44213214 TTTGCAAAGAGGAGGAAGGAGGG + Exonic
1168557619 19:57356300-57356322 GCTTCAGAGGGGATGATGGAGGG + Exonic
925104552 2:1279676-1279698 TTTTCAGATGGGAAGTTGGCTGG + Intronic
926549118 2:14279772-14279794 GTCTCAAAGAGGAGGATGGATGG - Intergenic
926552920 2:14321635-14321657 TTCTCGAAAGGGAAGAAGGATGG - Intergenic
927739253 2:25552749-25552771 ATTTCAAAGTGGTAGACGGAGGG - Intronic
928033725 2:27802477-27802499 ATTTCACGGGGGAAGAGGGAGGG + Intronic
928161172 2:28926431-28926453 TTTTTAAAGGGGAAGATGAGAGG - Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929433538 2:41908951-41908973 TTTTGAAAGAGGAAGAGGGAAGG + Intergenic
931303121 2:61000674-61000696 TTTCCAAAGGGGAAGAAAGTTGG - Intronic
931459797 2:62440711-62440733 TCTTCATAGGGGAGGCTGGAGGG - Intergenic
932437288 2:71710004-71710026 AAGTCAAAGGGGAAGATGGAGGG - Intergenic
932785163 2:74594628-74594650 TTTTCAGAGGCCAAGATGGGAGG + Intronic
935069094 2:99677747-99677769 TTCTGAAAGGGAAAGATGAATGG + Intronic
935650116 2:105374698-105374720 TTTTAAAAGGCAAATATGGAGGG - Intronic
935920236 2:108004780-108004802 TTTCCACAGGTGGAGATGGAGGG - Intronic
936281955 2:111149330-111149352 TTTTGAAAGGAGAAGAAAGAGGG - Intronic
937547759 2:123044913-123044935 TTTTCAAAGGTAAAGTTAGAAGG - Intergenic
938115215 2:128597823-128597845 TTTTCAAAAAGGAAGTTGAAAGG + Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
938561304 2:132474628-132474650 GTTTCAAGGGGCAAGATAGATGG - Intronic
938573629 2:132584646-132584668 ATTTCCAAAGGGAAGATGAAAGG + Intronic
938983691 2:136551798-136551820 TTTTAAAAGGGCAACATGGCCGG - Intergenic
939245272 2:139615575-139615597 TTTTGAAATGGGAAGATGAGTGG + Intergenic
939595907 2:144121863-144121885 TTTTTAAAGGTGAAGATGAAGGG - Intronic
941334761 2:164228728-164228750 TTTTAAACTGGAAAGATGGAAGG + Intergenic
944295737 2:198060220-198060242 TTTTCAGCGGTGAAGATGGCAGG - Intronic
944324049 2:198382647-198382669 TTTCCAAAGGGGAAGGCAGAAGG + Intronic
945442377 2:209895425-209895447 TTTTCAAAGGCGAGGGTGGGTGG - Intronic
945956342 2:216089695-216089717 TTTTGGAAGGGCAAGATGGGCGG - Intronic
946482844 2:220073570-220073592 TTGTCAAAAGGGAAGATTGTTGG - Intergenic
946608766 2:221435557-221435579 TGTTAAAAGGGGAAAATGGCTGG + Intronic
946728714 2:222688052-222688074 TTTTTGAAGGGGGAGGTGGAAGG - Intronic
947475199 2:230439994-230440016 TTTTCGAAAGGAAAGAAGGAAGG + Intronic
948075779 2:235164171-235164193 TTCTCAAGGGGGAAGGTGGGGGG + Intergenic
948242855 2:236452830-236452852 TTTTAAAAAAGGAAGTTGGATGG - Intronic
948372159 2:237496261-237496283 TTTTCCAAGGAGCAGAGGGAGGG + Intronic
1169338540 20:4777313-4777335 TTTTGAAAGGGTAAGGTGGGTGG - Intergenic
1169431368 20:5539280-5539302 CTTTCAGAGGGGAAGGTGGGTGG + Intergenic
1169668924 20:8072711-8072733 TTTTAAAAGTAGAAGAAGGAGGG + Intergenic
1169738558 20:8864932-8864954 TTATCTGATGGGAAGATGGAAGG + Intronic
1172901843 20:38340883-38340905 TTTTCAAAGGAGGAAATAGAGGG - Intergenic
1172924540 20:38520404-38520426 TTTTGAATGGGGAAGATTGTTGG + Intronic
1174416734 20:50372556-50372578 AATGCCAAGGGGAAGATGGAGGG + Intergenic
1175664739 20:60848973-60848995 TTTTTAAATGTGAAGATGTATGG + Intergenic
1175688734 20:61050421-61050443 TTTTCCAAGGGGGAGTTGCAAGG - Intergenic
1175825607 20:61934879-61934901 CTTGCAAAGGGGAAGATGGAAGG - Intronic
1175868876 20:62197900-62197922 GTTTCAGTGGAGAAGATGGAGGG + Exonic
1177300522 21:19238856-19238878 TTTTTAAAGTGAAAGAAGGATGG - Intergenic
1177812792 21:25942881-25942903 AGTTCAGTGGGGAAGATGGATGG - Intronic
1177942308 21:27425745-27425767 TTCTCAGAGGGGGAGATGGAAGG + Intergenic
1178474505 21:32925444-32925466 TTTTAAAAGAGGAAGATGTATGG + Intergenic
1178793285 21:35720282-35720304 TTTTCAAAGGGCAAGTTTCAAGG - Intronic
1180871973 22:19151253-19151275 TTTTCAAAGGTCAAGAGGAAAGG - Intergenic
1180926174 22:19556448-19556470 TTTCCACAGGGGTACATGGATGG - Intergenic
1181719835 22:24765114-24765136 TTTTCAAGAGGGCAAATGGATGG + Intronic
1181814655 22:25429264-25429286 TTTTTAGAGGGGAAGCTGGTGGG + Intergenic
1181827072 22:25525683-25525705 TTTTTTAAGGGGATCATGGAGGG + Intergenic
1182748937 22:32626535-32626557 TTTTCAGAGGGGAGGAAGGAAGG + Intronic
1182797088 22:32998807-32998829 TTTTTAAAAAGGAGGATGGAGGG - Intronic
1183547327 22:38461471-38461493 TTTCCAGGTGGGAAGATGGAGGG - Intergenic
1184235646 22:43181701-43181723 TTTTAAAAGGGGAACAGAGACGG - Intronic
1185271169 22:49929807-49929829 TTCTAAAAGGGGAACTTGGAAGG + Intergenic
949493317 3:4609645-4609667 TATTCAATGGAGAACATGGAGGG + Intronic
949606211 3:5657093-5657115 TTTTTAAAGGGGATCATGGAGGG + Intergenic
950915435 3:16640286-16640308 TTTTAAAAGGGAAATATGGAGGG - Intronic
951121813 3:18937174-18937196 TTTTCAAAGGTGAACATGCTGGG + Intergenic
951409900 3:22350287-22350309 TTTTAAAAGGAAAAGATGTATGG + Intronic
953309464 3:41863181-41863203 TTTGGAAAGGGGAAGGAGGAAGG - Intronic
954091159 3:48285380-48285402 TTTCCAAAGGGGCAGAGGGCAGG - Intronic
954885296 3:53868115-53868137 TTTCCAAAGGTAAAGATGGAAGG - Exonic
955117508 3:56020425-56020447 TTTTCACAGTGGCAGCTGGATGG - Intronic
955578273 3:60389968-60389990 TTTTCAGAGGAGCAGATGAAAGG - Intronic
955731026 3:61986656-61986678 TTCTCAAAAGGGAAGAGGTAAGG - Intronic
955963896 3:64368438-64368460 TTTTCAAACGGGGAGATTGATGG - Intronic
956388867 3:68750299-68750321 TTTTTAAAAGGGAAGACGAATGG + Intronic
956567281 3:70652959-70652981 TTTTCAAAGTAGAAGCTGGAAGG - Intergenic
957164318 3:76651727-76651749 AGTTAAAAGGGGGAGATGGAAGG - Intronic
957766206 3:84628363-84628385 TTTTAAAAGAGAAAGATGAAAGG + Intergenic
957824340 3:85421458-85421480 TTTTCAAAGCCAAAGAAGGATGG + Intronic
959018227 3:101159928-101159950 TTTTCAAGTGGAAAGATGGGTGG - Intergenic
959181770 3:102989250-102989272 TTTTGGCAGGGCAAGATGGAAGG - Intergenic
959372411 3:105544290-105544312 CTTTGATAGGGGAAGATGTAAGG - Intronic
960373303 3:116867605-116867627 TTTTGAAATGTGAAGATGGCTGG + Intronic
960556717 3:119038119-119038141 TTTGCAAAGGGGGAGGGGGAGGG - Intronic
963137380 3:141919358-141919380 TTTTCAAAGGCGGAGGTGGGTGG - Intronic
963687515 3:148455766-148455788 AATTCAAAGGGGAAGAAGAAAGG - Intergenic
963967572 3:151389839-151389861 TTTATAAAGGAGAAGATGGAAGG - Intronic
966128673 3:176609746-176609768 TTTACAAAGGGGAAAAATGATGG + Intergenic
966458076 3:180141002-180141024 AGTTGAAAGGAGAAGATGGAGGG - Intergenic
966569212 3:181422177-181422199 CTTTTATGGGGGAAGATGGAGGG - Intergenic
966742713 3:183249324-183249346 TTTTCACAGGGGCTGTTGGAGGG + Intronic
966799761 3:183752156-183752178 TGGTCAAAGGCAAAGATGGAGGG - Exonic
967386456 3:188916423-188916445 TTTTGAAAGGCTGAGATGGAAGG + Intergenic
967899495 3:194434994-194435016 TTCTCAATGGGGAAGGAGGAGGG + Intronic
968518091 4:1023253-1023275 CTTTCAAAGGGGACGATGACCGG + Intronic
968728114 4:2257574-2257596 TTGTCCGAGGGGCAGATGGAGGG - Intronic
969232816 4:5843339-5843361 GCTACAAAGGGGAAGGTGGATGG - Intronic
971203624 4:24538299-24538321 TTTTTAAAGGGGAAACTGTATGG - Intronic
971908754 4:32765493-32765515 TTTTCAATTGGGAAGCAGGAAGG + Intergenic
972303141 4:37805070-37805092 TTTTCAAACAAGGAGATGGAGGG + Intergenic
973605593 4:52584198-52584220 CTTCCACAGTGGAAGATGGAAGG - Intergenic
973720381 4:53717919-53717941 TTTTTAAAAAGTAAGATGGAGGG - Intronic
974106791 4:57478652-57478674 TTTTTCAGTGGGAAGATGGATGG - Intergenic
974140728 4:57883207-57883229 TTTTTACAGGGGAGGGTGGATGG + Intergenic
974375317 4:61069021-61069043 TGTAAAAAGTGGAAGATGGAAGG - Intergenic
974713420 4:65633472-65633494 TTAATAAATGGGAAGATGGAAGG + Intronic
975743046 4:77449256-77449278 ATTACAAAGGGGAAAATGGCAGG - Intergenic
975844197 4:78507732-78507754 TCTGGAAAGGGGATGATGGAAGG - Intronic
976359830 4:84164835-84164857 TTTTCAAAGAGGAAGAAGTGAGG + Intergenic
976522547 4:86045857-86045879 TTTTCAAACAGGAACATGAAGGG - Intronic
976822754 4:89225483-89225505 TATTCAACGGAGTAGATGGAGGG - Intergenic
978503955 4:109436728-109436750 CCTTCAAAGGGGATGATGGGTGG - Intronic
979192092 4:117874296-117874318 TTTTCAAATGGGAGGAGGGCAGG - Intergenic
979710360 4:123772126-123772148 TTATCAGAGGGAAAGAAGGAAGG - Intergenic
980549362 4:134313942-134313964 TTTTAGAATGGGAAGATGGTAGG + Intergenic
981052841 4:140328090-140328112 GTTTTAAATGGGAAGATGCAGGG + Intronic
981660119 4:147157158-147157180 GTTTACAAGGGCAAGATGGATGG + Intergenic
981727089 4:147859973-147859995 TTTTTAAAGGGGAAAATGTTAGG + Intronic
981880684 4:149607833-149607855 TTTACACAAAGGAAGATGGATGG + Intergenic
981972300 4:150678635-150678657 TTATGAAAGGGGAACAAGGAGGG + Intronic
982493311 4:156057551-156057573 TTTTTAAAAAGGAAAATGGATGG - Intergenic
983817927 4:172155292-172155314 TTTTAAAAGGGTACGATGGCCGG - Intronic
983952532 4:173659491-173659513 TTTGCAAATGGGAATATAGAAGG + Intergenic
983954093 4:173676791-173676813 TTTCCACTGGTGAAGATGGAGGG - Intergenic
986242981 5:5978109-5978131 TTTACAAGGTGGAAGAGGGAAGG - Intergenic
986885850 5:12234631-12234653 TTTTCAAAGGAACTGATGGAGGG + Intergenic
987485132 5:18516850-18516872 TTTTTAAAGAGGCAGATGGTAGG + Intergenic
989098043 5:37798999-37799021 TTTTTAACAGAGAAGATGGAGGG + Intergenic
989727302 5:44601877-44601899 TTTTCAGAGGAGAAAATTGAAGG - Intergenic
990998267 5:61755517-61755539 TTGTAAAAGGGGAAGCTGAAGGG - Intergenic
991021745 5:61986424-61986446 TTTTTAAATGGAAAGACGGAAGG + Intergenic
991968154 5:72111628-72111650 TTTTCAAAGTCGAAGACAGATGG + Intronic
991997164 5:72399658-72399680 TTTTCAAGTGGGCAGATGTAAGG + Intergenic
992341458 5:75828011-75828033 TTTTAAAATATGAAGATGGAGGG - Intergenic
993030991 5:82705607-82705629 TTTGCTAAGGGAAAGATAGATGG - Intergenic
993620507 5:90162497-90162519 TGTCCAAAGGGGAAGCTGTAGGG + Intergenic
994112443 5:96021949-96021971 TATTCAAGGGGAAAGAAGGATGG + Intergenic
995199624 5:109411331-109411353 TTTTCAAAGAGGTACTTGGATGG - Intergenic
996487848 5:124057706-124057728 TTTTCAAAGTGAAAAAGGGAGGG + Intergenic
996624102 5:125549063-125549085 TTTCAAAAGGGGAAAATAGATGG - Intergenic
997384405 5:133461278-133461300 TTATGACAGGGGAGGATGGATGG - Intronic
997871334 5:137507633-137507655 GTTGCAAAGGGGCAGGTGGAAGG - Intronic
998819675 5:146047430-146047452 TTTTCATAGAGGGAGATGGGTGG + Intronic
998914264 5:146997004-146997026 TTTTAAAAGGTGGAAATGGAAGG - Intronic
999254754 5:150204131-150204153 CTTGCAAAGAGGAAGATGGAGGG - Intronic
999265623 5:150265064-150265086 TTTGAGAAGGGGGAGATGGAGGG - Intronic
999480159 5:151940845-151940867 TTTCCAAGGGGGAGGATGCAAGG + Intergenic
1000543055 5:162565383-162565405 ATTGCAAAAGGGAAGATGAATGG - Intergenic
1001063107 5:168511356-168511378 TATTCATGGGGGAAGATGAAGGG + Intronic
1001171563 5:169424316-169424338 TTTCCAAAAGGTGAGATGGAAGG - Intergenic
1001226300 5:169947324-169947346 TTTTCCAAGGGGAATGAGGAGGG + Intronic
1001448846 5:171808432-171808454 TATTCAAAGGAGAATATAGAAGG - Intergenic
1003378284 6:5599212-5599234 TTTTAAATGAGGCAGATGGAAGG + Intronic
1003827841 6:9972129-9972151 CTTTCAGAGGCGAAGGTGGATGG - Intronic
1004485073 6:16058704-16058726 GTTTTTAAGGGAAAGATGGAGGG - Intergenic
1004924591 6:20404076-20404098 TTTTCTAGGGGGCGGATGGATGG + Intronic
1005489816 6:26337238-26337260 TGTTCAAAGCAGAAGAAGGATGG + Intergenic
1006715639 6:36118196-36118218 ATTTTAAAGTGGCAGATGGATGG - Intergenic
1007122812 6:39397429-39397451 TTTTCAAAGAGGAAAGAGGAAGG + Intronic
1007289497 6:40774714-40774736 ATGTCAATGGGGAAGATGGTGGG - Intergenic
1007505288 6:42330987-42331009 TTTTTAACGGGGAAGCTGTAGGG + Intronic
1008042545 6:46817058-46817080 TTTTCTAGGGGAAAAATGGAAGG + Intronic
1008355887 6:50552668-50552690 TTATAAAAGGGGTTGATGGAGGG - Intergenic
1008391812 6:50960588-50960610 ATTTGAAAGGGGAAGAGGGTGGG + Intergenic
1009680078 6:66880872-66880894 TTTTCCAAGTGCAAGATGGTGGG + Intergenic
1009833319 6:68967111-68967133 TTTTTAAAAAGGAAGATGGCAGG - Intronic
1010143554 6:72639505-72639527 TTTTCAAAAGGGACCATGCAGGG + Intronic
1010698320 6:79006986-79007008 TTTTAAAAGGAGGAGATGGGAGG + Intronic
1011058843 6:83238475-83238497 TTTTCAAAGGGTTTGATGAATGG - Intronic
1011097740 6:83684860-83684882 TTTTCAAAAGAACAGATGGAGGG + Intronic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1011478113 6:87767527-87767549 TTTCTAAAGGAGAAGCTGGAGGG + Intergenic
1011489277 6:87874116-87874138 TCTTCAAGGGAGAAGAGGGAGGG + Intergenic
1012008272 6:93744748-93744770 TTATCAAAAGGGAAGAGGAATGG + Intergenic
1012430001 6:99154158-99154180 TTTACAAAGGGGAAGAAGGAAGG - Intergenic
1013239173 6:108227448-108227470 AGTTCAAAAGGGAAAATGGAAGG - Intronic
1014811482 6:125891546-125891568 TTTTTAAGGGGCAAGATGCATGG - Intronic
1015632230 6:135243355-135243377 TTTTCAAAAGGGAAAATAGTTGG + Intergenic
1016135644 6:140538690-140538712 TTTTCAATGGGGAAAAAGGCAGG - Intergenic
1016615370 6:146041784-146041806 TTTTCTGTGAGGAAGATGGAAGG + Intronic
1017618651 6:156272597-156272619 TTTTTAAAAACGAAGATGGAAGG - Intergenic
1017626922 6:156358399-156358421 ATTTTAAAGGGGAAAAAGGAGGG + Intergenic
1017677819 6:156832314-156832336 TAATCCTAGGGGAAGATGGATGG - Intronic
1018102435 6:160453118-160453140 TTTTTAAATGGGCAGATTGAGGG - Intergenic
1018133353 6:160753346-160753368 TTTTTAAATGGGCAGATGGGGGG + Intergenic
1019804890 7:3116538-3116560 TTTTCAAAGGGAGAGAAGAATGG - Intergenic
1020760003 7:12257299-12257321 ACTTCAAATGGGAACATGGATGG + Intergenic
1021227514 7:18045653-18045675 TTCTCAAATGTGAACATGGAGGG + Intergenic
1021363745 7:19750085-19750107 TTTTCCTAGGGGAAGATCCAGGG - Intronic
1022239931 7:28500731-28500753 ATTTTAAGGGGGAAGCTGGAGGG + Intronic
1022335922 7:29421862-29421884 TTCTCAGAGGGGAAGATTTAAGG + Intronic
1022398252 7:30010284-30010306 TTTTCGAGGGGGAGGAGGGAGGG - Intergenic
1022553658 7:31269335-31269357 TTTTAAAAAGGGAAAATGGCAGG - Intergenic
1022591496 7:31667909-31667931 TATTCAAAGGGCAAGCAGGAGGG + Intergenic
1022611405 7:31877778-31877800 TTTTAAATTGGGAAGATGAAGGG + Intronic
1022866231 7:34423987-34424009 TTTTCAAAGGAGAAAAAGGGAGG - Intergenic
1023306888 7:38839930-38839952 AATGCAAAAGGGAAGATGGAAGG + Intronic
1024544968 7:50509333-50509355 TTTTCTTTGAGGAAGATGGAAGG - Intronic
1024745739 7:52404002-52404024 TTTTTAAAGGGGAAAATAGAGGG + Intergenic
1026279244 7:68906833-68906855 TCTTTCAAGGGGAAAATGGATGG - Intergenic
1027628985 7:80579039-80579061 GTTTAAAAGGGGAAGAAAGAAGG + Intronic
1027694909 7:81398331-81398353 TTTTTAAAGAGGAAGAAGAAGGG - Intergenic
1027745414 7:82067929-82067951 TTTTCATAGGGCAAGGTAGAAGG - Intronic
1027865548 7:83641206-83641228 TTTTCAAAGGAAAAGATGATGGG - Intronic
1028044869 7:86105910-86105932 TTTGTAGTGGGGAAGATGGAAGG + Intergenic
1028535059 7:91882373-91882395 TAGTCAAAGGGGAAGAGTGATGG - Intergenic
1029276851 7:99410538-99410560 TTTAAAAAGGCAAAGATGGAAGG - Intronic
1029389003 7:100262422-100262444 TATTCAGAGGGGAAAAAGGAAGG - Intronic
1029806691 7:103004842-103004864 TTTTCAGAGGGGGAGAGTGAAGG + Intronic
1030821198 7:114094032-114094054 TTTTTATGGGGAAAGATGGAGGG + Intronic
1030821935 7:114103880-114103902 AATTCAAAGGGGGAGATTGAAGG - Intronic
1031387976 7:121176174-121176196 TTTCCAGCGGGGAGGATGGAGGG - Intronic
1031820350 7:126493186-126493208 TATTCAAAGTGGAAAATAGAGGG + Intronic
1032155377 7:129463469-129463491 TTTTCAAAGGGGAAGATGGAAGG - Intronic
1032176322 7:129630503-129630525 TTTTCAAAAGGGATTATAGAAGG + Intronic
1032978620 7:137254720-137254742 TTTTGAAAAGGGAAGATTGAAGG + Intronic
1033796131 7:144847620-144847642 TATTAAAAGGGGAAGAAGGGAGG - Intergenic
1033865035 7:145679820-145679842 TTTCCAAAAGAGATGATGGATGG + Intergenic
1034110075 7:148528279-148528301 TTTCCAGAGGAGAAGCTGGACGG - Intergenic
1034281590 7:149858795-149858817 TTTTGAAAGGGGCACTTGGAGGG - Intronic
1035337874 7:158141716-158141738 TTTTCAAAGGGGAAAATCAGAGG - Intronic
1035819808 8:2579272-2579294 TTTTAGATGGGGAAGATGGGGGG - Intergenic
1036076359 8:5506184-5506206 TTTTCTAAGTTGAAGAAGGATGG - Intergenic
1036590494 8:10163745-10163767 TCATCAAAGGGGAGGATGGCTGG + Intronic
1037200762 8:16249720-16249742 GTTTAAAAAGGGAAGTTGGAAGG + Intronic
1037674130 8:21039696-21039718 ATTTGAAAGGGAAAGATGGATGG - Intergenic
1038296550 8:26296750-26296772 TTTTGAAAGGGGAAGAGAAATGG + Intronic
1038819239 8:30937085-30937107 TTTCCAGTGGGGAAGATGCATGG + Intergenic
1039141328 8:34391915-34391937 TTTTGAAAGGGGAATATACAGGG + Intergenic
1039735027 8:40322683-40322705 TTTTTAACAGGGAAGATGAAAGG + Intergenic
1041625999 8:60027808-60027830 TTTTTTCAGTGGAAGATGGAGGG + Intergenic
1041706057 8:60847405-60847427 TTTTCAAATGGGAAAACTGATGG - Intronic
1042818770 8:72907468-72907490 TATGCAAAGAAGAAGATGGATGG + Intronic
1043305179 8:78784871-78784893 CTTTTCAAGGAGAAGATGGAGGG - Intronic
1045068317 8:98473484-98473506 TTTCTAAAGGAGAAGAGGGATGG - Intronic
1045290143 8:100825961-100825983 CATTCAAAGGGGAAGAACGAGGG + Intergenic
1046860573 8:119086693-119086715 TTATAGAAGGGGAAGAAGGAAGG + Intronic
1046973416 8:120247683-120247705 CTTTCACCGGGGAAGATGGGGGG - Exonic
1047652760 8:126941530-126941552 TTTTCAAAGGGTAAGATTTATGG - Intergenic
1047952829 8:129949374-129949396 TTTTCAGATGAGAAAATGGAGGG + Intronic
1048237032 8:132701021-132701043 TATCCATGGGGGAAGATGGAAGG + Intronic
1048519791 8:135142857-135142879 GTTTGAAAGAGGAAGATGAAGGG + Intergenic
1048893298 8:138966662-138966684 TTTTTAAAGGGGGAGAAGGGTGG + Intergenic
1050173668 9:2848115-2848137 TTTGGGAAGGGGAAGATGTATGG - Intergenic
1050296963 9:4215212-4215234 CTTTCAGAGGGGAGGTTGGAAGG - Intronic
1050301039 9:4259341-4259363 TATGTAAAGGGGAAGGTGGAAGG - Intronic
1050420082 9:5454289-5454311 TTTTTAAAGGGAAAAAAGGAAGG - Intronic
1050609594 9:7337640-7337662 TTTTTAAAGGAGAAGGTAGATGG + Intergenic
1051169178 9:14301590-14301612 TTTTCAAAGGGAAGGGTGGGGGG - Intronic
1052231536 9:26160317-26160339 TTTCATCAGGGGAAGATGGATGG + Intergenic
1052904627 9:33822805-33822827 TTTTTTAGGGGGAAGAGGGAAGG - Intronic
1053402613 9:37839481-37839503 TTTTGGAAGGCCAAGATGGATGG - Intronic
1053409872 9:37909062-37909084 TGTTCAAAGGCCCAGATGGATGG + Intronic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1055758602 9:79582121-79582143 TTTTGAAGGGGGAAGCTGGGAGG + Intronic
1057287697 9:93773488-93773510 ATTTTAAAGGGGATCATGGAGGG + Intergenic
1057602971 9:96474976-96474998 TAATGAAAGGAGAAGATGGAAGG - Intronic
1057618279 9:96613158-96613180 TCTTCACAGGGGAATGTGGAGGG + Intronic
1057972051 9:99567830-99567852 TTTAAAAAGGGGAAGAAGGCTGG + Intergenic
1058058904 9:100474549-100474571 TTTTCAAAGGGGAGGAGGCTTGG + Intronic
1058263872 9:102873383-102873405 TAATAAAAGGGGAAAATGGAAGG + Intergenic
1059068995 9:111115541-111115563 TTTACAAATGGGAAAATTGAGGG - Intergenic
1061640332 9:131949264-131949286 TTGTGAAAGGGGAGGATGGCGGG + Intronic
1062720747 9:138042616-138042638 TTTTCAACAGGGAAGTTTGATGG + Intronic
1186294110 X:8130166-8130188 TTGACAGAGGAGAAGATGGAAGG + Intergenic
1186693395 X:12003771-12003793 TTTTTAAAGGGGAAAGTGAAAGG - Intergenic
1186748435 X:12595227-12595249 TTTCCAAAAGTGAAGATGGATGG + Intronic
1187622820 X:21077660-21077682 TTACCAAATGAGAAGATGGAGGG + Intergenic
1188217520 X:27497467-27497489 TTTGCCAAGGGCAAGAAGGATGG - Intergenic
1188292623 X:28407527-28407549 TTTTCAATGGGGAAGGGAGAGGG + Intergenic
1188832917 X:34922854-34922876 TTTTAACAGTGGAAGATTGAGGG - Intergenic
1189020509 X:37332928-37332950 ATTTGAAAGGGGAAAATGTAGGG + Intergenic
1190493010 X:51001644-51001666 TATTTAAAAGGGAAGCTGGAGGG - Intergenic
1192243949 X:69358070-69358092 TTCTCAATGGGAAAGATGAAGGG - Intergenic
1192324308 X:70119204-70119226 GTTTCTAAGGGGATCATGGAGGG + Intergenic
1193653935 X:84174700-84174722 TCTTCATAGGGTAAGGTGGAAGG - Intronic
1194313608 X:92344994-92345016 TTTTAAAAAGGAAAGATGAAGGG - Intronic
1195800903 X:108708758-108708780 TTTTCAAGGTGGAAGGTGGAAGG + Intergenic
1196766451 X:119249836-119249858 TTTTCAAAGTGGAAGCGTGATGG - Intergenic
1196974706 X:121146534-121146556 TTTTCCAAGGAGAACATAGAAGG + Intergenic
1197677469 X:129346093-129346115 ATTGCAAAAGGGAAGGTGGATGG + Intergenic
1198842649 X:140875526-140875548 TTTTCAAGGGGGTAGTTGGGAGG + Intergenic
1199270939 X:145881915-145881937 TCTTGAAAGGGGAATGTGGATGG + Intergenic
1199837717 X:151609403-151609425 TTTTCAAAGCTGGAAATGGATGG - Intronic
1200621879 Y:5459115-5459137 TTTTAAAAAGGAAAGATGAAGGG - Intronic