ID: 1032156630

View in Genome Browser
Species Human (GRCh38)
Location 7:129474800-129474822
Sequence TCAAGACTACCTCAGCCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032156630 Original CRISPR TCAAGACTACCTCAGCCCAG CGG (reversed) Intronic
900793518 1:4694148-4694170 TTACGACCAGCTCAGCCCAGGGG + Intronic
901024955 1:6274262-6274284 TCAAGACAGCCACAGCCAAGAGG + Intronic
905154665 1:35965791-35965813 TCAAGTCTACCTCAGTTAAGTGG - Intronic
905474693 1:38217778-38217800 TCAGGTCTCCCCCAGCCCAGTGG - Intergenic
908168481 1:61482060-61482082 TGAAGACAACCTCAGCATAGGGG + Intergenic
916177368 1:162053785-162053807 ACATAACCACCTCAGCCCAGAGG - Intergenic
917589345 1:176460559-176460581 GACAGAATACCTCAGCCCAGTGG - Intergenic
918128304 1:181603733-181603755 TCAAGAATTCCTCAGAACAGAGG - Intronic
920299100 1:204977562-204977584 CCTAGAACACCTCAGCCCAGAGG + Intronic
922193839 1:223342260-223342282 TAAAGACAACATCAGCCCTGAGG - Intronic
1063121058 10:3106103-3106125 GCAATACAACCTCATCCCAGTGG + Intronic
1064671114 10:17714703-17714725 TCAACTCTGCCTCAGCCCGGAGG + Exonic
1065356445 10:24846486-24846508 TCACGACTGCATCAGCCCTGAGG - Intergenic
1072285393 10:93909567-93909589 TCAAGAGTCCCTCAAACCAGAGG - Intronic
1073236861 10:102024161-102024183 TCAAAACTACCTGAGCGCAGTGG + Intronic
1074908697 10:117887655-117887677 TCCATACTACCTGAGCACAGAGG - Intergenic
1075614109 10:123878804-123878826 TCAAGGCCACGTCAGCCCTGTGG + Intronic
1081756495 11:45548518-45548540 TCAAGACCAGCCCAGCACAGTGG + Intergenic
1082793454 11:57363549-57363571 TCTAAACTACCTCAGTCCAGAGG + Intronic
1084860985 11:72018128-72018150 TCCAGACCACCTCAGCCCTGAGG + Intronic
1085253072 11:75156261-75156283 ACAAGACAACCTCTGCCCTGGGG + Intronic
1089629817 11:119777555-119777577 TCAGCACCACCCCAGCCCAGAGG - Intergenic
1090190712 11:124765153-124765175 TCAAGACTGCCTCAGCCATTAGG + Intergenic
1091597512 12:1888113-1888135 GCAAGACTAGGTCAGACCAGTGG - Intronic
1091722821 12:2825692-2825714 TCAAGACTGTTTCAGCCCAACGG + Exonic
1094852393 12:34388149-34388171 TCAAGACTTCCTGACCCCCGTGG + Intergenic
1099691768 12:85963721-85963743 ACAAGACTTCATCAGCCCTGGGG - Exonic
1103155795 12:118683872-118683894 TCAAGAAGACCTCAGCCTTGTGG - Intergenic
1105657103 13:22453571-22453593 GAAACACTACCTCAGCCCTGTGG + Intergenic
1106226519 13:27790667-27790689 TCCAGCCTGCCTCTGCCCAGCGG + Intergenic
1106898407 13:34330046-34330068 TGAAGACTACTTCAGGCTAGCGG + Intergenic
1113603558 13:111588513-111588535 TCAAGCCTTCCTCAGCCAACAGG - Intronic
1116783670 14:49265420-49265442 ACAAGGCTACAGCAGCCCAGGGG + Intergenic
1117473363 14:56069012-56069034 TCAATACTACCCCTGCTCAGAGG + Intergenic
1119348669 14:73946497-73946519 TGACGAGTTCCTCAGCCCAGAGG - Exonic
1124872158 15:33553912-33553934 TCAAGGCAACCTCAGGCAAGTGG - Intronic
1125827430 15:42688287-42688309 TCAAGACTTCCTAAGCCCCAAGG - Exonic
1126415979 15:48417822-48417844 GCAAGAAGACATCAGCCCAGGGG - Intronic
1128998130 15:72311846-72311868 TCAAGGCTTTGTCAGCCCAGAGG - Intronic
1130216871 15:81979953-81979975 TGAACACTACCTCAGCCAAGAGG - Intergenic
1132057110 15:98660756-98660778 TCAAGATCACCTCATCCCTGTGG + Intronic
1133606067 16:7389349-7389371 GGAGGACTACCTGAGCCCAGGGG - Intronic
1133998355 16:10763906-10763928 TCAAGAGCATCTCAGCCCATGGG + Intronic
1133998378 16:10764014-10764036 ACAGGAGTACCTCAGCCCATGGG + Intronic
1134653632 16:15929937-15929959 GGAAGACTGCCTGAGCCCAGGGG + Intergenic
1135412478 16:22245591-22245613 TTAAGAACACCTCAGCCCGGAGG + Intronic
1136345972 16:29676284-29676306 ACAAGACTGCCTCAGTGCAGAGG + Intronic
1140575470 16:76162929-76162951 TCAAGACTAGCTTAGCCAACAGG - Intergenic
1143228775 17:5332974-5332996 TGAAGCCTACCTTAGCCCATAGG - Intronic
1143744841 17:8985096-8985118 TCAAGTCTACCTCAGAGCTGGGG - Intergenic
1144737665 17:17564056-17564078 TCAAAACCACCTTAGCCAAGAGG - Intronic
1146638117 17:34520904-34520926 TCCAGCCTTCCTCAGGCCAGGGG - Intergenic
1146703409 17:34981134-34981156 TCACAACTGCCGCAGCCCAGGGG - Intronic
1147772441 17:42877310-42877332 CCAAGGCTAACCCAGCCCAGGGG - Intergenic
1148792830 17:50183332-50183354 CCCAGACCACCCCAGCCCAGGGG + Exonic
1150623339 17:66824457-66824479 TCAAGACAACCTCAGAGGAGCGG - Intergenic
1152201270 17:78947822-78947844 TCAGGCCTCCCACAGCCCAGAGG - Intergenic
1159128788 18:64256359-64256381 TCAAGCCTTCCTTAACCCAGTGG - Intergenic
1163401180 19:17093781-17093803 GCAGGACTACTTGAGCCCAGCGG - Intronic
1163459414 19:17427621-17427643 ACAAGACTACAACAGCCCAGAGG - Intronic
1163713240 19:18859492-18859514 TCAGAAGTCCCTCAGCCCAGGGG - Intronic
1164444727 19:28307546-28307568 TCAGGACTGCTTAAGCCCAGAGG + Intergenic
1164803239 19:31094792-31094814 TGAAGACAAATTCAGCCCAGAGG + Intergenic
1165691328 19:37865995-37866017 GCAAGACTGCCTGAGCCCGGAGG - Intergenic
927217404 2:20675846-20675868 CCACACCTACCTCAGCCCAGGGG - Intergenic
928582365 2:32721956-32721978 TCAAGCCTACCTCATACCAATGG + Intronic
931235431 2:60408782-60408804 TCTAGACTCACTCAACCCAGTGG - Intergenic
932125740 2:69144235-69144257 TCCAGCCTCCCTCTGCCCAGTGG + Intronic
932232753 2:70095930-70095952 CCAAGGCTCACTCAGCCCAGTGG - Intergenic
935183373 2:100709548-100709570 TCATGAGTACCTCTGCCCAAGGG - Intergenic
935259061 2:101339019-101339041 TCAAAATTCCCTCAGCCCTGAGG + Intergenic
935659001 2:105449335-105449357 CCAAGACTTCCTGAGCACAGAGG + Intergenic
935787473 2:106561761-106561783 TGAAGACAACCTTAGTCCAGTGG - Intergenic
936023454 2:109013108-109013130 ACAACACTGGCTCAGCCCAGTGG + Intergenic
936126619 2:109794198-109794220 TCAAGACACCCTCAGACCACAGG + Intronic
936218074 2:110577270-110577292 TCAAGACACCCTCAGACCACAGG - Intergenic
936427519 2:112433699-112433721 TCAAGACACCCTCAGACCACAGG - Intronic
936476312 2:112843029-112843051 TCAAGACTCACACAGCACAGAGG - Intergenic
936616282 2:114050893-114050915 TCAGACCTATCTCAGCCCAGAGG - Intergenic
937319998 2:120955405-120955427 CCACGACTACCTCAACCCCGTGG + Exonic
938290652 2:130148120-130148142 GGAAGATTGCCTCAGCCCAGGGG - Intergenic
940479887 2:154214727-154214749 CCAAGACCTCCTCAGCCCTGTGG + Intronic
940860320 2:158764394-158764416 TCAAAACTACTTCAGCCAACAGG + Intergenic
944132526 2:196362195-196362217 CCACGACTGCCTCAGCCGAGGGG - Intronic
1170213149 20:13865466-13865488 TCAGGAATTTCTCAGCCCAGTGG + Intronic
1171392542 20:24811006-24811028 TCCAGAAAGCCTCAGCCCAGAGG - Intergenic
1175598818 20:60256381-60256403 GCAAGGCCACCTGAGCCCAGGGG + Intergenic
1176429565 21:6567504-6567526 TCTAGCCTACCCCAGGCCAGAGG - Intergenic
1177880695 21:26690437-26690459 TCAAGACTTTATCAGCCCTGGGG + Intergenic
1178525624 21:33325843-33325865 TCAAGACTCCATCTACCCAGAGG - Intronic
1178851331 21:36214950-36214972 GGAAGACCACCTGAGCCCAGGGG + Intronic
1179704959 21:43174966-43174988 TCTAGCCTACCCCAGGCCAGAGG - Intergenic
1180869304 22:19137448-19137470 CCAAAACCACCTCAGGCCAGAGG + Intronic
1181417548 22:22771518-22771540 CCATGACCAACTCAGCCCAGGGG + Intronic
1182282437 22:29225245-29225267 CCAGGGCTCCCTCAGCCCAGGGG - Intronic
949858418 3:8483356-8483378 AGACGACTTCCTCAGCCCAGTGG - Intergenic
950450173 3:13060884-13060906 TAAATCCCACCTCAGCCCAGGGG + Intronic
955208271 3:56917132-56917154 ACAAGTCTACCTCACCCAAGAGG - Intronic
955792732 3:62605285-62605307 TCAGGACTTCTTCAGCTCAGAGG - Intronic
956487358 3:69737190-69737212 TCAGGACAACCTCAGCTCAGAGG + Intergenic
957899553 3:86471107-86471129 TCCAGACCACCTCAGACCAAAGG + Intergenic
958984393 3:100763506-100763528 TCAAGACTAGCAAAGCCCAGAGG - Intronic
959301795 3:104611971-104611993 TCAAAACAACTTCAGTCCAGAGG - Intergenic
960983371 3:123253252-123253274 TTTAGACTACATAAGCCCAGGGG + Intronic
963111440 3:141691817-141691839 CCAAAACTAGCTCTGCCCAGTGG - Intergenic
963920861 3:150903349-150903371 ACAGGACTATCTCAGCCCAAAGG - Exonic
965303282 3:167031233-167031255 ACATAACTACCTTAGCCCAGGGG + Intergenic
970687046 4:18580419-18580441 TCGTGCCAACCTCAGCCCAGTGG - Intergenic
973224806 4:47771231-47771253 TCAGGACTACATCAGCAGAGTGG + Intronic
973816162 4:54621453-54621475 TCAAAATTAGCTAAGCCCAGTGG - Intergenic
980569212 4:134588869-134588891 TCAATACAAACTCACCCCAGGGG - Intergenic
990348774 5:54895091-54895113 TCAAGTCTTCCTCAGTCCACAGG + Intergenic
990707228 5:58542942-58542964 TCAACAGTGCATCAGCCCAGAGG + Intronic
992633957 5:78709423-78709445 TCAAGACTACCACTGCGCGGTGG - Intronic
993778461 5:92033482-92033504 TGAAGGCTGCCTCAGTCCAGTGG - Intergenic
999488324 5:152023000-152023022 TCAAGTCAACTTCAGCCCTGGGG - Intergenic
1002797739 6:488341-488363 TGAAGACTGCCTCAGCTCGGGGG + Intronic
1004855926 6:19749808-19749830 TGAAGATTAACTCACCCCAGGGG - Intergenic
1011989731 6:93499455-93499477 TCAATAATACCTCAGTCCAGAGG - Intergenic
1015180409 6:130355810-130355832 GCAGGAGTACTTCAGCCCAGTGG + Intronic
1015399279 6:132770305-132770327 TCAAAACATCCTCAGCACAGAGG - Exonic
1017587340 6:155941537-155941559 TCAAGAATAACTCAGGCTAGTGG - Intergenic
1019163631 6:170085123-170085145 ATAAGAATACCTGAGCCCAGAGG + Intergenic
1022093422 7:27123171-27123193 CCAAGACTGCCTCTGGCCAGTGG - Intronic
1023616496 7:42025278-42025300 TGAAGACCTCCCCAGCCCAGGGG - Exonic
1026344352 7:69461420-69461442 CCAAGAGTGCCTCAGACCAGGGG + Intergenic
1026503295 7:70960825-70960847 TCATGACTACCTTGGCCCAGTGG - Intergenic
1027266564 7:76498081-76498103 TCCACACTTCCACAGCCCAGGGG - Intronic
1027317945 7:76996199-76996221 TCCACACTTCCACAGCCCAGGGG - Intergenic
1029726676 7:102410576-102410598 TCAAGACTCCCTCAGATCTGGGG + Intronic
1031660538 7:124418833-124418855 GCAAGATTACCTCAGCCATGTGG - Intergenic
1032156630 7:129474800-129474822 TCAAGACTACCTCAGCCCAGCGG - Intronic
1032962074 7:137047394-137047416 TCAAGATTACCCCAGACCAAAGG + Intergenic
1033132150 7:138753810-138753832 ACAAGAGCACCTCAGCACAGAGG + Intronic
1033417917 7:141180554-141180576 TCTAGTTTACCTCTGCCCAGAGG + Intronic
1033534526 7:142299651-142299673 TCAAGACAAACTCAGGCCACAGG - Intergenic
1034682314 7:152938600-152938622 TCAAGACTAGCTTGGCCAAGTGG - Intergenic
1036433215 8:8708514-8708536 TCTAGCCTCCCTCAGCCCCGTGG - Intergenic
1037113874 8:15200334-15200356 CCAGGACTTCCTCAGCCCTGGGG + Intronic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1045599754 8:103699315-103699337 ACAAGATTACCTGAGCCCAGGGG - Intronic
1048286306 8:133144446-133144468 TCTAGACAGCCTCAGCCCTGGGG + Intergenic
1053356004 9:37446014-37446036 GGAAGACTGCTTCAGCCCAGGGG + Intronic
1054923417 9:70564455-70564477 TCCACACTACCTCAGCCTACAGG + Intronic
1057821075 9:98331536-98331558 TCAGGACTCCCCCAGTCCAGGGG - Intronic
1060595498 9:124845601-124845623 TCAAATCTACCTCTTCCCAGGGG - Intergenic
1062268200 9:135696929-135696951 TCAAGCCAGCCTCTGCCCAGGGG + Intronic
1187277748 X:17831071-17831093 TCTTGCCTTCCTCAGCCCAGAGG - Intronic
1187572095 X:20515138-20515160 TCCATCCTACCTCTGCCCAGTGG + Intergenic
1192182923 X:68927525-68927547 CGAAGACTTCCTAAGCCCAGGGG + Intergenic
1192321655 X:70094970-70094992 GCAAGGCTACCTCTGCCCTGAGG - Intergenic
1193277424 X:79605318-79605340 TCAGGGCTCCCTCAGGCCAGGGG - Intergenic
1195298977 X:103508543-103508565 TAATGACTACCTAAGCCCTGAGG - Intronic
1196228790 X:113196689-113196711 TCAAGACTACCACAGGGCCGAGG + Intergenic