ID: 1032160046

View in Genome Browser
Species Human (GRCh38)
Location 7:129502876-129502898
Sequence AGCCCCAGGCTGTCCCGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 219}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032160038_1032160046 11 Left 1032160038 7:129502842-129502864 CCTAAAGTACCCGGGGCCAGGGC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1032160046 7:129502876-129502898 AGCCCCAGGCTGTCCCGGAGAGG 0: 1
1: 0
2: 1
3: 25
4: 219
1032160033_1032160046 18 Left 1032160033 7:129502835-129502857 CCGTCTCCCTAAAGTACCCGGGG 0: 1
1: 0
2: 0
3: 10
4: 71
Right 1032160046 7:129502876-129502898 AGCCCCAGGCTGTCCCGGAGAGG 0: 1
1: 0
2: 1
3: 25
4: 219
1032160040_1032160046 1 Left 1032160040 7:129502852-129502874 CCGGGGCCAGGGCGCGCGCCGTG 0: 1
1: 0
2: 1
3: 18
4: 277
Right 1032160046 7:129502876-129502898 AGCCCCAGGCTGTCCCGGAGAGG 0: 1
1: 0
2: 1
3: 25
4: 219
1032160039_1032160046 2 Left 1032160039 7:129502851-129502873 CCCGGGGCCAGGGCGCGCGCCGT 0: 1
1: 0
2: 0
3: 8
4: 155
Right 1032160046 7:129502876-129502898 AGCCCCAGGCTGTCCCGGAGAGG 0: 1
1: 0
2: 1
3: 25
4: 219
1032160036_1032160046 12 Left 1032160036 7:129502841-129502863 CCCTAAAGTACCCGGGGCCAGGG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1032160046 7:129502876-129502898 AGCCCCAGGCTGTCCCGGAGAGG 0: 1
1: 0
2: 1
3: 25
4: 219
1032160042_1032160046 -5 Left 1032160042 7:129502858-129502880 CCAGGGCGCGCGCCGTGGAGCCC 0: 1
1: 0
2: 2
3: 8
4: 150
Right 1032160046 7:129502876-129502898 AGCCCCAGGCTGTCCCGGAGAGG 0: 1
1: 0
2: 1
3: 25
4: 219
1032160029_1032160046 20 Left 1032160029 7:129502833-129502855 CCCCGTCTCCCTAAAGTACCCGG 0: 1
1: 0
2: 1
3: 3
4: 79
Right 1032160046 7:129502876-129502898 AGCCCCAGGCTGTCCCGGAGAGG 0: 1
1: 0
2: 1
3: 25
4: 219
1032160031_1032160046 19 Left 1032160031 7:129502834-129502856 CCCGTCTCCCTAAAGTACCCGGG 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1032160046 7:129502876-129502898 AGCCCCAGGCTGTCCCGGAGAGG 0: 1
1: 0
2: 1
3: 25
4: 219
1032160028_1032160046 30 Left 1032160028 7:129502823-129502845 CCATGGTAATCCCCGTCTCCCTA 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1032160046 7:129502876-129502898 AGCCCCAGGCTGTCCCGGAGAGG 0: 1
1: 0
2: 1
3: 25
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032160046 Original CRISPR AGCCCCAGGCTGTCCCGGAG AGG Intronic
900246986 1:1640897-1640919 CGCTCCAGGCTGTGCCGGTGGGG - Intronic
900258208 1:1708029-1708051 CGCTCCAGGCTGTGCCGGTGGGG - Intronic
900298936 1:1967175-1967197 AGCCCCAGGCTGACCCCAGGAGG + Intronic
900400550 1:2471238-2471260 TGGCCCTGGCTGTCCCGAAGAGG + Intronic
900501035 1:3004764-3004786 AGAGCCAGGCTGAGCCGGAGCGG - Intergenic
900886786 1:5420931-5420953 AGCTCCAGGCTATCCCCGCGAGG + Intergenic
901039555 1:6355816-6355838 AGCCCGAGCCTGTTCCGCAGCGG + Intronic
901070332 1:6513801-6513823 AGACCCAGGCTGCCTCGGATGGG + Intronic
901082872 1:6593344-6593366 AGCCCCAGTCTGGCCCGGCACGG - Exonic
901771668 1:11533636-11533658 AGCCCCAGGCAGTTCCAGGGAGG + Intronic
902090848 1:13902058-13902080 GGCCCCAGGCAGCCCCGGGGTGG + Intergenic
902656068 1:17869177-17869199 AGCTCCAGGCTGTTGGGGAGGGG - Intergenic
902715592 1:18270449-18270471 TGCCCGAGGCTGCCCTGGAGAGG - Intronic
903169552 1:21543750-21543772 AGCCCCAGACTGTCCAGGCTGGG - Intronic
903793055 1:25907118-25907140 AGCCCCACGCTTTCCCGCACAGG - Intergenic
905900257 1:41576678-41576700 AGCCCCATGCTGTCCTTGTGGGG - Intronic
906136904 1:43506325-43506347 AGCCCCAGCCTGGCCCGCAGGGG + Intergenic
906197260 1:43936732-43936754 AGCCGCAGGCGGTGGCGGAGAGG - Exonic
908572116 1:65420789-65420811 AGCCCCAGGCTTGACCGGAACGG - Intronic
912261288 1:108113554-108113576 AGCCCCAGGCTGGCTCCCAGTGG - Intergenic
912548269 1:110466571-110466593 AGCCCCAGGCTGGCACAGAGAGG + Intergenic
912566686 1:110592568-110592590 AGCCTGAGGCTGTTCCGCAGAGG + Intergenic
922056091 1:222043813-222043835 AGCCGCAGGCTGGGCAGGAGGGG + Intergenic
922766727 1:228159976-228159998 AGCTCCAGGCTGGCTGGGAGAGG + Intergenic
1067037072 10:42928417-42928439 AGTCCCAGGCTGTCCTGGAAAGG - Intergenic
1067711761 10:48656062-48656084 AGCCCCAGGCAGGCCCCGGGCGG - Intronic
1070600684 10:77864333-77864355 AGGCCCTGGCTGCCCGGGAGAGG + Intronic
1071334596 10:84590343-84590365 GTCCCCAGGCTGACCCGGAGGGG + Intergenic
1075593196 10:123707589-123707611 AGAGCCAGGCTGTCCCAGTGAGG + Intronic
1076814660 10:132908864-132908886 AGCCCTTGGCTGCCCCTGAGCGG + Intronic
1076874559 10:133209719-133209741 AGCCCCAGGCTGCCCTGCAAAGG - Intronic
1077102558 11:828612-828634 AGCCCCAGGCTTTCCAGGGCTGG - Exonic
1077153789 11:1082670-1082692 GGCCCTTGGCTGTCCCGGGGTGG + Intergenic
1077254257 11:1573339-1573361 AGCCCCAGGGTGACCCTGGGGGG - Intergenic
1079329154 11:19519847-19519869 AGGCCCAGGATCTCCCTGAGAGG - Intronic
1081658935 11:44876067-44876089 AGCTCCAGGCTGTGTCTGAGTGG - Intronic
1081931283 11:46873209-46873231 GGCCCCAGTCTGTCCAGAAGAGG + Exonic
1082160237 11:48882255-48882277 GGTCCCACGCTGTTCCGGAGTGG + Intergenic
1082162129 11:48898151-48898173 GGTCCCACGCTGTTCCGGAGTGG - Intergenic
1082167708 11:48966596-48966618 GGTCCCAGGCTGTTCCAGAGTGG - Intergenic
1082239300 11:49854610-49854632 GGTCCCACGCTGTTCCGGAGTGG + Intergenic
1083587648 11:63872180-63872202 AGCCCAAGGCTGCCACAGAGAGG - Intronic
1083859730 11:65413708-65413730 AGCCCCACGTTGCCCAGGAGGGG + Intergenic
1084171689 11:67404122-67404144 GGCCCCAGGCTGGCCGGGAGTGG + Intronic
1084672569 11:70615953-70615975 AGACCCCAGCTGTCCCTGAGAGG + Intronic
1085445531 11:76598354-76598376 AGCCCCAGGCTTGCCCAGTGAGG - Intergenic
1085446155 11:76602581-76602603 AGCCCCAGGAGGCCCAGGAGGGG - Intergenic
1089202612 11:116733516-116733538 AGCCCCAGGCTGGTGCGGATGGG + Intergenic
1089299656 11:117490903-117490925 AGCCCCAGCCTGCCCTGGACTGG - Intronic
1090844504 11:130519532-130519554 AGCCCCAGGTTCACCCTGAGCGG - Intergenic
1091217236 11:133909716-133909738 AGGCCCAGGCAGTCCAGGAAGGG - Intronic
1091383488 12:77804-77826 TTCCCCAGGCTGGCCCGGCGAGG - Intronic
1095180785 12:39144916-39144938 CGGCCCAGCCGGTCCCGGAGAGG + Intergenic
1098029640 12:66240646-66240668 TGCCTCAGGCTGTCCCAGAGGGG + Intronic
1103986728 12:124772341-124772363 AGCCCCACGCTGACCCCGAGAGG + Intergenic
1104001608 12:124863918-124863940 AGCCCAAGGCTGCCCGGGGGCGG - Intronic
1104633515 12:130424286-130424308 ACCCCCAGCCCGGCCCGGAGAGG - Intronic
1104858436 12:131912717-131912739 AGCCCCAGACAGACCCGGGGAGG + Intronic
1104889275 12:132132578-132132600 ACCCCCAGGCCTTCCTGGAGTGG + Intergenic
1106227406 13:27795421-27795443 TGCCCCAGGGAGTCCCCGAGAGG + Intergenic
1108436281 13:50404642-50404664 AGCCCCAAGCTGTCAAAGAGGGG - Intronic
1112503196 13:99957581-99957603 AGTCCTAGGCTGTGCGGGAGTGG + Intergenic
1113882475 13:113635397-113635419 AGACCCAGGGTGGCCGGGAGAGG + Intronic
1115854059 14:37611089-37611111 AGTCCGAGGCTGCCCCGGAGCGG + Intronic
1119615780 14:76098204-76098226 AGCTCCAGGCTGACACGGATGGG + Intergenic
1122836719 14:104434257-104434279 TGCCCCACACTGTCCCCGAGGGG + Intergenic
1123037174 14:105476203-105476225 AGCCCCAGGCTGGCCTGGCCCGG - Intronic
1123122193 14:105921847-105921869 AGCCCCAGGCAGTGCAGGAGTGG - Intronic
1123404857 15:20013412-20013434 AGCCCCAGGCAGTGCAGGAGTGG - Intergenic
1123495247 15:20817128-20817150 AGCCGCAGGCTGTGGCGGAGGGG + Intergenic
1123514188 15:21020060-21020082 AGCCCCAGGCAGTGCAGGAGTGG - Intergenic
1123551736 15:21386221-21386243 AGCCGCAGGCTGTGGCGGAGGGG + Intergenic
1125678048 15:41512910-41512932 AGCCCCTGGCTGGGCCAGAGGGG + Intronic
1128322155 15:66701598-66701620 GGCTCCAGGCTCGCCCGGAGTGG - Intergenic
1128635853 15:69302007-69302029 AGCCCCAGTCTGTCTCTCAGCGG + Intronic
1129115460 15:73363103-73363125 AGCCGCAGGCTGTGTTGGAGGGG - Intronic
1129706317 15:77796594-77796616 GGCCCCAGGCTGACCCCGAGAGG + Intronic
1130026794 15:80277171-80277193 AGGCTGAGGCTGTCCCCGAGGGG - Intergenic
1132025105 15:98398745-98398767 AGCCACAGGCTGGACGGGAGTGG - Intergenic
1202960081 15_KI270727v1_random:113463-113485 AGCCGCAGGCTGTGGCGGAGGGG + Intergenic
1132892183 16:2209865-2209887 AGCTCCAGCCTGTCCCGTACTGG + Intronic
1133076629 16:3285216-3285238 ACCCCCAGGCTGTAAAGGAGAGG + Exonic
1136153624 16:28367992-28368014 GGGCCCAGGCTGGCCCGGGGCGG + Intergenic
1136209463 16:28747275-28747297 GGGCCCAGGCTGGCCCGGGGCGG - Intergenic
1136785313 16:32930690-32930712 ATCCCCAGGCTGGCCAGCAGAGG - Intergenic
1137901306 16:52272056-52272078 ACCGCCAGGCTGTCACTGAGCGG - Intergenic
1138098675 16:54233883-54233905 AGCCCCAGGCTTTGCAAGAGTGG + Intergenic
1139920266 16:70455252-70455274 AGCCCCACGCTGTCCAAGACTGG - Intronic
1139956450 16:70695487-70695509 AGTCCAAGGCTGCCCTGGAGTGG - Intronic
1140248346 16:73271419-73271441 AAGCCCAGGCTGCTCCGGAGGGG + Intergenic
1141772730 16:86101004-86101026 AGCCACAGGCAGGCCCGGGGAGG + Intergenic
1142150851 16:88511982-88512004 AGCCCCCGGCCATCCCTGAGTGG + Intronic
1142672878 17:1495426-1495448 GGCCTCAGGCTGTCTGGGAGGGG - Exonic
1142720064 17:1770071-1770093 AGCCCCAGGCAGACCTGGAGAGG + Intronic
1143481055 17:7227599-7227621 AGCAGAAGGCTGTCCCGCAGTGG - Intronic
1144639682 17:16930592-16930614 AGCTCGAGGCTGGCCTGGAGGGG + Intronic
1144788265 17:17843807-17843829 ACCTCCAGGCTCTCCCGGAGAGG - Intronic
1145013905 17:19384754-19384776 AGCCCCGAGCTGGCCGGGAGAGG + Intronic
1145755420 17:27386563-27386585 AGCCCCAGAGTGGCCCTGAGTGG + Intergenic
1146923470 17:36728924-36728946 AGCCCCTGGGTGTCCCCGACTGG - Intergenic
1147360776 17:39928155-39928177 TGGCCCAGGCTGCCCCGGACCGG + Intergenic
1151522717 17:74641646-74641668 GGACCCAGGATGTCCAGGAGGGG + Intergenic
1151681874 17:75626674-75626696 GGCCCCAGGCCGTCCTGGAGAGG - Intergenic
1152277946 17:79369069-79369091 GCCCCCAGGCTGTCCAGGGGTGG - Intronic
1152320928 17:79608598-79608620 AGGCCCAGGCTGTCTCGGCTTGG + Intergenic
1152357911 17:79815488-79815510 AGCCCCAGGCCGGCCTCGAGGGG + Intergenic
1152825705 17:82463489-82463511 AGCCCCAGGCTCACCCTGGGTGG - Intronic
1154123157 18:11667811-11667833 AGGCCCAGGCTGGCCCAGATGGG - Intergenic
1154221345 18:12457467-12457489 AGCCCCAGGCAGTGCCGTGGTGG - Intronic
1154452645 18:14489602-14489624 AGCCGCAGGCTGTGGCCGAGGGG + Intergenic
1157101017 18:44729842-44729864 AACCCCAGGAGGTCCCGGGGAGG + Intronic
1157294499 18:46433100-46433122 AGCCCCAGGCTGCCCCGGGTGGG + Intronic
1157570125 18:48706658-48706680 AGCCTCAGCCTGCCCTGGAGTGG + Intronic
1160578075 18:79868220-79868242 AGCCCAGGGTTGTCCCTGAGAGG - Intronic
1161108792 19:2456990-2457012 AGTCCCAGGCTGCCCCGCCGCGG - Exonic
1161250644 19:3278211-3278233 AGCCCCTGGCTGTCCTTCAGAGG + Intronic
1161563904 19:4988896-4988918 AGACCCAGGCTGGACGGGAGGGG - Intronic
1162567109 19:11450692-11450714 AGCCACAGGCAGGCCCAGAGGGG - Exonic
1162771962 19:12954421-12954443 AGGCCCAGGCTGACAAGGAGAGG - Exonic
1162798546 19:13098924-13098946 TGCCCCTGGGTCTCCCGGAGGGG + Intergenic
1163268673 19:16236123-16236145 AGCCCCAGGGTTTTCTGGAGGGG - Intronic
1163640252 19:18458012-18458034 TGCCCCAGGGTGTCCCGTGGTGG - Intronic
1163645354 19:18486139-18486161 ACCCCCAGGCTGCCCTGCAGAGG + Intronic
1165353079 19:35287315-35287337 AGGCCCAGGCTGGGCGGGAGAGG + Intergenic
1165773393 19:38390736-38390758 AACCCCAGGCTGTTCCACAGGGG + Intronic
1166998390 19:46730654-46730676 AGGCCCAGGCTGACTCGGAAGGG + Intronic
1167246772 19:48377707-48377729 AACCCCAGGCTGGCCAGGCGTGG - Intergenic
925188847 2:1867170-1867192 AGCCCCAGGAAGTCACTGAGTGG + Intronic
926089612 2:10041912-10041934 AGGCCCAGGCTGTCCCTCCGGGG + Intergenic
926243220 2:11103714-11103736 GGCCCCAGGCTTGCCCGCAGAGG + Intergenic
927331320 2:21866939-21866961 AGCCCCAGGGTGGCACAGAGTGG - Intergenic
929604955 2:43227556-43227578 AGGCCCAGGCTGTGCCGGGCGGG - Intergenic
931711926 2:64995393-64995415 AGCCCTCAGCTGTCCCTGAGAGG - Intronic
936284875 2:111174061-111174083 ATCCCCAGTCTGTCCCCGAAGGG - Intergenic
938023760 2:127927096-127927118 AGCCAGAGGCAGGCCCGGAGCGG + Intergenic
941979009 2:171434463-171434485 AGGCCCAGACTTTCCCGGCGGGG - Exonic
945119371 2:206442911-206442933 CGCCGCAGGCTGGCGCGGAGTGG - Intergenic
946221301 2:218230008-218230030 TGCCCCAGGCTGTACTGCAGTGG + Intronic
946361437 2:219221267-219221289 AGGCCCAGGCTGAACCTGAGCGG - Exonic
948485857 2:238280270-238280292 CTCACCAGGCTGTCCTGGAGTGG - Intronic
948648898 2:239426606-239426628 AGGCCCTGGCTGTCCAGGAGGGG + Intergenic
948811026 2:240478516-240478538 AGCCACAGGCTGCCCCTGGGAGG - Intergenic
948823892 2:240565066-240565088 GGCCACAGGATGTCCAGGAGAGG - Intronic
949036093 2:241816397-241816419 AGCCCCAGGCAGTCTCGGGCAGG - Exonic
1169342948 20:4810138-4810160 AGCGCCAGGCTGGTCCTGAGTGG - Intronic
1170926852 20:20732857-20732879 AGACCCTGGCCCTCCCGGAGGGG - Intergenic
1171455756 20:25271215-25271237 GGCCCCAGGCTCTCATGGAGAGG + Intronic
1172507462 20:35474022-35474044 TGCACCTGGCTGTCCGGGAGAGG + Exonic
1172870181 20:38130943-38130965 AGCCCCAGGGTGTCTGGGAGTGG + Intronic
1173150428 20:40562278-40562300 AGCCACAGGCTGTGCCCAAGAGG + Intergenic
1174420386 20:50395587-50395609 GGCCCCAGGCTGGCCCAGGGTGG + Intergenic
1174731332 20:52920966-52920988 GGCCCCAGATTGTCCCGTAGAGG - Intergenic
1175988007 20:62773787-62773809 TGCCCAAGGCTGTCATGGAGAGG + Intergenic
1176180129 20:63746067-63746089 AGCTCCAGCCCGTCCAGGAGGGG + Exonic
1176281690 20:64316983-64317005 TTCCCCAGGCTGGCCCGGCGAGG + Intergenic
1176297528 21:5082152-5082174 AGCCCCAGGCCTCCACGGAGAGG - Intergenic
1176443388 21:6798682-6798704 AGCCGCAGGCTGTGGCCGAGGGG - Intergenic
1176821556 21:13663729-13663751 AGCCGCAGGCTGTGGCCGAGGGG - Intergenic
1179318851 21:40270761-40270783 AGCCCCAAGCTGCCCCCAAGCGG - Intronic
1179510713 21:41871435-41871457 AGCCACAGGCTGTCCCTGTCTGG + Intronic
1179550805 21:42142278-42142300 AGCCACCGTCTGTCCCGAAGAGG + Exonic
1179559888 21:42208936-42208958 TGCCCCAGGCCCTCCTGGAGAGG + Intronic
1179859501 21:44179796-44179818 AGCCCCAGGCCTCCACGGAGAGG + Intergenic
1179928140 21:44549938-44549960 ATGCCCAAGCTGTCCCTGAGTGG + Intronic
1180163152 21:46006952-46006974 AGCCCAGGGGTGACCCGGAGAGG - Intergenic
1180694714 22:17744320-17744342 GGCCACAGGCTGTTCCGGGGAGG + Intronic
1180754368 22:18150118-18150140 AGACCAAGGCGGGCCCGGAGCGG + Exonic
1181013825 22:20057125-20057147 AGCCCCAGGCGTCCCTGGAGGGG + Intronic
1181516106 22:23414746-23414768 AGCCCAAGGAGGTCCTGGAGGGG + Intergenic
1181653038 22:24271328-24271350 AGCCCCAGCCTCTCCCGGAGCGG - Intronic
1182559365 22:31147726-31147748 TGCCCAAGGCTGCCCAGGAGGGG - Intergenic
950716805 3:14853500-14853522 GGTCCCAGCCTGTCTCGGAGGGG + Intronic
952497534 3:33928945-33928967 TCCCCCAGGCTGTCCAGGGGAGG + Intergenic
952827806 3:37538516-37538538 AGCCCCTGTCTGTCCCTGGGAGG - Intronic
958047700 3:88304888-88304910 AGGCCCAGGCTGTACCTGAAGGG - Intergenic
958478342 3:94614345-94614367 AGGCCCAGGCTGACACGGGGAGG - Intergenic
961479184 3:127168551-127168573 GGCCCCAGGCTGACCTGGAAGGG - Intergenic
963503770 3:146160743-146160765 AGACCCCGGCGGTCCTGGAGAGG + Intronic
963607635 3:147424495-147424517 AGCCCCCGGGTGGCCCGGACTGG - Intronic
963909909 3:150807980-150808002 AGGCCCAGGCTGCCATGGAGTGG + Intergenic
964725873 3:159814102-159814124 AGCCACAGGCAATCCCGAAGAGG - Intronic
968067183 3:195765140-195765162 AGCCCCAGCCTGGGCCTGAGTGG - Intronic
968073934 3:195805543-195805565 AGCCTCGGGCTGTCCTGGTGTGG + Intronic
968794211 4:2691540-2691562 AGCCCCTGGCTGTCACTTAGGGG + Intronic
977249248 4:94671025-94671047 AGCCCCAGGCTGTCCTTTAGAGG - Intergenic
978013740 4:103719487-103719509 AGCCACAGGCAGTCCCAGCGCGG + Exonic
982468511 4:155759513-155759535 ATGCCCAGCCTCTCCCGGAGCGG + Intronic
985747692 5:1656416-1656438 AGCCCCAGGGTGGACCGGAGGGG - Intergenic
985856142 5:2429010-2429032 AGACCCAGGCTGTCCAGTCGTGG - Intergenic
989387348 5:40866889-40866911 ACCCCCAAGGTGTCACGGAGGGG - Intergenic
994748006 5:103702710-103702732 AGCCACAGGCTGGCCAGGCGCGG - Intergenic
997261152 5:132466475-132466497 AGCTCCAGGCTGCACCGAAGCGG + Intronic
1000062278 5:157668288-157668310 AGCTCCAGGCTGTCAGGCAGGGG + Intronic
1000919705 5:167123278-167123300 AGCCCCAGGCTGCACTGCAGTGG - Intergenic
1001969856 5:175946892-175946914 TGCAGCAGGCTGTCCCAGAGAGG - Intronic
1002070470 5:176676431-176676453 AGCCCCAGGGGGACTCGGAGTGG + Intergenic
1002071199 5:176679829-176679851 AGCCCCAGGGTGACAGGGAGAGG - Intergenic
1002247582 5:177896876-177896898 TGCAGCAGGCTGTCCCAGAGAGG + Intergenic
1004313127 6:14563560-14563582 AGCCCCAGGCTTTCCCAGCCAGG - Intergenic
1006136148 6:31897413-31897435 AGCCGCCGGCTGCCCCTGAGTGG - Intronic
1007410056 6:41656413-41656435 AGCCTCAGGCTGGCCAGGGGTGG - Intergenic
1011842312 6:91516906-91516928 ATCCCTAGACTGTCCCTGAGTGG + Intergenic
1014163550 6:118197831-118197853 AGCCACTGGCTGTCCCAGTGGGG - Intronic
1017761603 6:157573818-157573840 AGCCCCAGGATGTCCCTGCCAGG + Intronic
1018633901 6:165843789-165843811 AGCCTGAGCCTATCCCGGAGGGG + Intronic
1018984420 6:168625394-168625416 AGCTCCTCGCTGTGCCGGAGAGG + Intronic
1019400038 7:847425-847447 ACCCCCAGGGGATCCCGGAGAGG - Intronic
1019400276 7:848107-848129 ACCCCCAGGGGATCCCGGAGAGG - Intronic
1019400299 7:848179-848201 ACCCCCAGGGGATCCCGGAGAGG - Intronic
1019528986 7:1494355-1494377 AGCCCCAGGCGGGGCTGGAGGGG + Intronic
1019559394 7:1648445-1648467 TGGCCCAGCCTGTCCCGGGGAGG + Intergenic
1020960148 7:14792417-14792439 AGTCCCAGGCCTTCCCTGAGTGG - Intronic
1024895683 7:54259314-54259336 AGCCTCAGCCTGTCCCGCGGAGG + Intergenic
1025261961 7:57425782-57425804 AGGCCCAGGCAGTCCCGGAATGG + Intergenic
1025615486 7:63113503-63113525 AGGCCCAGACAGTCCCAGAGTGG - Intergenic
1025739287 7:64182999-64183021 AGGCCCAGGCAGTTCAGGAGTGG + Intronic
1026000652 7:66557470-66557492 CAGCCCAGGCAGTCCCGGAGTGG + Intergenic
1026901127 7:74038135-74038157 AGCCCCAGACTTCCCCTGAGTGG + Intronic
1029625654 7:101718785-101718807 ATCCCCAGAGTGTTCCGGAGAGG + Intergenic
1032160046 7:129502876-129502898 AGCCCCAGGCTGTCCCGGAGAGG + Intronic
1032470154 7:132172410-132172432 TGCTTCAGGCTGTCCTGGAGGGG - Intronic
1036704359 8:11035504-11035526 AGCCCCAGGGTGGCCTGGGGAGG + Intronic
1037700709 8:21271688-21271710 AGCCCCAGAGTGTTCTGGAGGGG + Intergenic
1037817592 8:22120253-22120275 AGTCCCAGGGTGACCCCGAGGGG - Intronic
1038441158 8:27571720-27571742 AGATGCAGGCTGTCCTGGAGGGG - Intergenic
1038643955 8:29348586-29348608 AGCCCCCCGCTGTCCGGCAGGGG + Intronic
1040298776 8:46177158-46177180 AGCCCCAGGCTTTGCAGCAGGGG + Intergenic
1040305944 8:46211822-46211844 GCCCCCAGGCTGTCCCAGACGGG + Intergenic
1040338817 8:46429675-46429697 GCCCCCAGGCTGTCCCGGGCAGG + Intergenic
1041051565 8:53939644-53939666 CGCCCCAGGCCAGCCCGGAGCGG + Exonic
1044204464 8:89476222-89476244 AGCCCCAGTCTGTCTCCAAGAGG - Intergenic
1049531699 8:143158563-143158585 GGCCCCGAGCTGACCCGGAGGGG - Intronic
1049632830 8:143668130-143668152 AGCCTCAGCCTGCCCCAGAGAGG + Intergenic
1050183189 9:2942516-2942538 AGCCACAGGCTTTCCCGTGGGGG - Intergenic
1057273864 9:93665903-93665925 AGGCCCATCCTGCCCCGGAGAGG + Intronic
1061151255 9:128829543-128829565 AGCCGCAGGGGGTTCCGGAGAGG + Intronic
1061521783 9:131122527-131122549 GGTCCCAGCCTGTCCCAGAGAGG - Exonic
1062214878 9:135383854-135383876 AGCCCCAGGCAGCCCCGCACAGG - Intergenic
1062339477 9:136087575-136087597 AGCCCAAGGCAGACCCAGAGAGG - Intronic
1203525813 Un_GL000213v1:85845-85867 AGCCGCAGGCTGTGGCCGAGGGG + Intergenic
1203746818 Un_GL000218v1:44687-44709 TGCCCCAGACTGCCCCTGAGGGG - Intergenic
1190417277 X:50192373-50192395 AGCTCCAGGCTGTCCTGCAGTGG - Exonic
1190927536 X:54922587-54922609 AGCCCCAGGCTCCCCGGGGGAGG - Exonic
1198312230 X:135434581-135434603 AGCTGCAGGCTGCCCAGGAGGGG + Intergenic
1200072720 X:153537023-153537045 GGCCACAGGCTGTCCCAAAGAGG + Intronic
1200086820 X:153611163-153611185 AGCCCCAGGAAGTGCTGGAGGGG - Intergenic