ID: 1032163322

View in Genome Browser
Species Human (GRCh38)
Location 7:129526984-129527006
Sequence CTGTTGCTTTTAAAGACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032163322_1032163330 -6 Left 1032163322 7:129526984-129527006 CCATTGGTCTTTAAAAGCAACAG No data
Right 1032163330 7:129527001-129527023 CAACAGTGGGGGTTGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032163322 Original CRISPR CTGTTGCTTTTAAAGACCAA TGG (reversed) Intergenic
No off target data available for this crispr