ID: 1032166303

View in Genome Browser
Species Human (GRCh38)
Location 7:129547733-129547755
Sequence CAGAGGAAACAAAAAGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032166303_1032166315 20 Left 1032166303 7:129547733-129547755 CCTCCACCTTTTTGTTTCCTCTG No data
Right 1032166315 7:129547776-129547798 ATGCCCATCCACATTGGTGACGG No data
1032166303_1032166311 -6 Left 1032166303 7:129547733-129547755 CCTCCACCTTTTTGTTTCCTCTG No data
Right 1032166311 7:129547750-129547772 CCTCTGGGCCCTCGGTGGATTGG No data
1032166303_1032166314 14 Left 1032166303 7:129547733-129547755 CCTCCACCTTTTTGTTTCCTCTG No data
Right 1032166314 7:129547770-129547792 TGGATGATGCCCATCCACATTGG No data
1032166303_1032166317 23 Left 1032166303 7:129547733-129547755 CCTCCACCTTTTTGTTTCCTCTG No data
Right 1032166317 7:129547779-129547801 CCCATCCACATTGGTGACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032166303 Original CRISPR CAGAGGAAACAAAAAGGTGG AGG (reversed) Intergenic
No off target data available for this crispr