ID: 1032168786

View in Genome Browser
Species Human (GRCh38)
Location 7:129566908-129566930
Sequence CTGTGGTAGGGGATGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032168786_1032168798 24 Left 1032168786 7:129566908-129566930 CCCCCCACCATCCCCTACCACAG No data
Right 1032168798 7:129566955-129566977 AATAAATTAGGTGAGCATGGTGG No data
1032168786_1032168800 28 Left 1032168786 7:129566908-129566930 CCCCCCACCATCCCCTACCACAG No data
Right 1032168800 7:129566959-129566981 AATTAGGTGAGCATGGTGGTGGG No data
1032168786_1032168799 27 Left 1032168786 7:129566908-129566930 CCCCCCACCATCCCCTACCACAG No data
Right 1032168799 7:129566958-129566980 AAATTAGGTGAGCATGGTGGTGG No data
1032168786_1032168797 21 Left 1032168786 7:129566908-129566930 CCCCCCACCATCCCCTACCACAG No data
Right 1032168797 7:129566952-129566974 TGAAATAAATTAGGTGAGCATGG No data
1032168786_1032168796 12 Left 1032168786 7:129566908-129566930 CCCCCCACCATCCCCTACCACAG No data
Right 1032168796 7:129566943-129566965 TTGAATCTCTGAAATAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032168786 Original CRISPR CTGTGGTAGGGGATGGTGGG GGG (reversed) Intergenic
No off target data available for this crispr