ID: 1032174586

View in Genome Browser
Species Human (GRCh38)
Location 7:129612399-129612421
Sequence GCCCACGCCACCCCGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032174586_1032174591 -2 Left 1032174586 7:129612399-129612421 CCTCCTGCCGGGGTGGCGTGGGC 0: 1
1: 0
2: 1
3: 21
4: 214
Right 1032174591 7:129612420-129612442 GCTTGTTACCCAGGTAGACTGGG 0: 1
1: 0
2: 1
3: 11
4: 108
1032174586_1032174597 14 Left 1032174586 7:129612399-129612421 CCTCCTGCCGGGGTGGCGTGGGC 0: 1
1: 0
2: 1
3: 21
4: 214
Right 1032174597 7:129612436-129612458 GACTGGGGGACGCTGGAATATGG 0: 1
1: 0
2: 0
3: 17
4: 154
1032174586_1032174593 0 Left 1032174586 7:129612399-129612421 CCTCCTGCCGGGGTGGCGTGGGC 0: 1
1: 0
2: 1
3: 21
4: 214
Right 1032174593 7:129612422-129612444 TTGTTACCCAGGTAGACTGGGGG No data
1032174586_1032174596 7 Left 1032174586 7:129612399-129612421 CCTCCTGCCGGGGTGGCGTGGGC 0: 1
1: 0
2: 1
3: 21
4: 214
Right 1032174596 7:129612429-129612451 CCAGGTAGACTGGGGGACGCTGG 0: 1
1: 0
2: 0
3: 12
4: 187
1032174586_1032174590 -3 Left 1032174586 7:129612399-129612421 CCTCCTGCCGGGGTGGCGTGGGC 0: 1
1: 0
2: 1
3: 21
4: 214
Right 1032174590 7:129612419-129612441 GGCTTGTTACCCAGGTAGACTGG 0: 1
1: 0
2: 0
3: 19
4: 217
1032174586_1032174592 -1 Left 1032174586 7:129612399-129612421 CCTCCTGCCGGGGTGGCGTGGGC 0: 1
1: 0
2: 1
3: 21
4: 214
Right 1032174592 7:129612421-129612443 CTTGTTACCCAGGTAGACTGGGG 0: 1
1: 0
2: 1
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032174586 Original CRISPR GCCCACGCCACCCCGGCAGG AGG (reversed) Intronic
900090836 1:919778-919800 GCCCACGTCCGCCCAGCAGGTGG + Intergenic
900229662 1:1550274-1550296 CTCCACGCCAGCCCGGCTGGGGG + Intronic
900348146 1:2221180-2221202 GCTCACCCCACCCTGTCAGGTGG + Intergenic
900505476 1:3028134-3028156 ACCCCCGCCACCCGGGAAGGCGG - Intergenic
900535207 1:3173637-3173659 GCCCACGCCTCTGGGGCAGGCGG - Intronic
901496877 1:9627319-9627341 GCTGCCGCCACCCCTGCAGGAGG - Intergenic
901653562 1:10756437-10756459 GCTCACGCGAGCCCGGCAGCCGG + Intronic
901841432 1:11956479-11956501 GCCCAGGCCTCCCCTGCATGTGG + Intronic
902578282 1:17392246-17392268 CCCCACCCCTCCCCGACAGGTGG - Intronic
904488313 1:30842383-30842405 TTCCACGCCACCCAGGAAGGGGG + Intergenic
905875875 1:41431874-41431896 GCCCTCCAGACCCCGGCAGGGGG - Intergenic
910772222 1:90841920-90841942 GCCTACGCAGCCCTGGCAGGAGG + Intergenic
912381278 1:109249550-109249572 TCCCTCGCCTCCCCGGCGGGCGG - Intergenic
913632674 1:120724482-120724504 TCACACGCCTCCTCGGCAGGAGG + Intergenic
914286047 1:146228435-146228457 TCACACGCCTCCTCGGCAGGAGG - Intronic
914547078 1:148679188-148679210 TCACACGCCTCCTCGGCAGGAGG - Intronic
914619429 1:149391174-149391196 TCACACGCCTCCTCGGCAGGAGG + Intergenic
914994833 1:152534379-152534401 GCTCCTGCCGCCCCGGCAGGAGG - Intronic
915339818 1:155170726-155170748 GCCCTCTCCACCTGGGCAGGTGG - Intronic
916694597 1:167221894-167221916 GCCCGCGCGCCCCCGGCCGGCGG + Intronic
922729413 1:227942077-227942099 GCCCGGGCCACCCCAGCAGCCGG + Intronic
924852798 1:247847554-247847576 GTCCTAGCCACCCTGGCAGGAGG - Intergenic
1063368400 10:5505291-5505313 GCCTACCCCACGACGGCAGGTGG - Intergenic
1064167861 10:13001787-13001809 GCCCACGCCCCAGCCGCAGGGGG - Intronic
1067055838 10:43049399-43049421 GCCCTCCCCACCACAGCAGGAGG + Intergenic
1067850088 10:49749258-49749280 GCCCAGGCCTCCCAGGGAGGGGG + Intronic
1068669341 10:59708866-59708888 GCCTTCGCCACCGCCGCAGGAGG - Intronic
1070600976 10:77866086-77866108 GCACACACCGCCCTGGCAGGAGG - Intronic
1070750973 10:78963825-78963847 GCCCACGCCAAGCAGGCAGATGG + Intergenic
1070768014 10:79067517-79067539 GCGCTCCCCTCCCCGGCAGGCGG - Intergenic
1072409038 10:95183748-95183770 GGCCCCGCCGCCCCAGCAGGGGG + Intergenic
1074021943 10:109593549-109593571 GCCCACGCCACCAGGGCCTGGGG + Intergenic
1074529767 10:114289169-114289191 GCCCACCCCACCTAGGTAGGGGG - Exonic
1075619125 10:123912665-123912687 GCCCTCTCCACTCCGGCTGGAGG + Intronic
1076221757 10:128739510-128739532 GCCCACAGCATCCAGGCAGGAGG - Intergenic
1076687242 10:132203743-132203765 GCCCCCACCCCCCCGGCAGCTGG + Exonic
1080827635 11:35861358-35861380 GCCCATGCCACCCTGGAAGCTGG + Intergenic
1081541804 11:44040036-44040058 GCCAAGGCCACACAGGCAGGGGG + Intergenic
1084737373 11:71114203-71114225 GCTCAGGCCACCCTGGGAGGTGG - Intronic
1084769339 11:71332408-71332430 GCCCCAGCCACAGCGGCAGGTGG + Intergenic
1085011135 11:73142328-73142350 GCCCCCGCCCGCCCGGGAGGAGG + Intergenic
1085027474 11:73244977-73244999 GCCCACTCCACCCCAGCTGCAGG - Intergenic
1089507272 11:118972091-118972113 CCCCAAGCCTCCCCGGGAGGTGG - Intronic
1089622221 11:119728681-119728703 GCCCACCCCGCCCCGGCCGACGG - Exonic
1090385477 11:126355671-126355693 GTCCCCGCCTCCCCTGCAGGCGG + Intronic
1091330539 11:134728184-134728206 GCCCCAGCCACCACGGGAGGAGG - Intergenic
1093298151 12:17416925-17416947 GCCCACCCCGCCACAGCAGGTGG + Intergenic
1095800805 12:46268734-46268756 GGCCACGCCACTCCGCCAGAAGG - Intronic
1096010866 12:48213176-48213198 GCCCAAGCCAACAGGGCAGGTGG - Intergenic
1096309116 12:50504952-50504974 GCCCCCGCCCCCCGGCCAGGAGG - Intergenic
1096598674 12:52714397-52714419 GCCGCCGCCACCCCGGCTGACGG + Intergenic
1101365354 12:104064982-104065004 CCCCACCCCAGCCCGACAGGCGG + Intronic
1101371883 12:104138026-104138048 GCCAACGCCGCCGCGGCCGGGGG - Intronic
1102951265 12:117033159-117033181 GCCCACGTCACCCGTGCAGCCGG + Intergenic
1103909508 12:124344597-124344619 GCCCACGCCGCGCCTGCAGGAGG - Exonic
1104738159 12:131152749-131152771 GCCCACCCCACCGCAGCAGCTGG + Intergenic
1104783960 12:131437971-131437993 CCCCACCCCACCACGGCAGTGGG + Intergenic
1104843055 12:131833816-131833838 GCCCAGGGCACCCTGGCTGGCGG - Intronic
1107095084 13:36527325-36527347 GCCCACGGCTCCCCAGCAGTTGG - Intergenic
1111672601 13:91348482-91348504 GCCCACGCCACGCCGCCCGCTGG - Intergenic
1112577634 13:100650542-100650564 AACCACGCCACCCCGACAGGTGG + Intronic
1117029289 14:51652075-51652097 GCCGCCGCCCCGCCGGCAGGGGG - Intronic
1118249590 14:64146808-64146830 GCCATCGCCATCACGGCAGGCGG + Intronic
1118734462 14:68691599-68691621 GCCCACAGCACCCCAGGAGGGGG - Intronic
1119831956 14:77711369-77711391 GGCCACTGCACCCCTGCAGGGGG - Intronic
1120195408 14:81477001-81477023 GCCAGCTCCACCCCAGCAGGAGG - Exonic
1121231638 14:92362912-92362934 GCAGACGCCATGCCGGCAGGTGG + Intronic
1123845797 15:24300807-24300829 GCCTCAGCCACCCCTGCAGGTGG + Intergenic
1123998224 15:25733627-25733649 GCCCAGAACACCCCGGCTGGTGG + Intronic
1125300999 15:38252993-38253015 ACCCCGGCCACCCCCGCAGGGGG - Exonic
1132551250 16:554718-554740 GCCCAGGCATCCCGGGCAGGCGG + Intergenic
1132577049 16:668931-668953 GCTGCTGCCACCCCGGCAGGAGG - Intronic
1133221996 16:4322826-4322848 GCCCACGCCTCCCCTGCCTGGGG - Intronic
1134448690 16:14349829-14349851 GCCTCAGCCACCCCAGCAGGTGG + Intergenic
1135597420 16:23754973-23754995 GGCCACGCCTCTCCGGCGGGAGG + Exonic
1136777297 16:32878777-32878799 CCCCACCCCACCCCTCCAGGGGG - Intergenic
1136893328 16:33982736-33982758 CCCCACCCCACCCCTCCAGGGGG + Intergenic
1136927501 16:34388559-34388581 GCCCCCGCCACCTCCGCCGGTGG - Intergenic
1136977073 16:35023247-35023269 GCCCCCGCCACCTCCGCCGGTGG + Exonic
1136983958 16:35082995-35083017 CCCCAGGCCACCCCTGCATGGGG + Intergenic
1137537329 16:49337343-49337365 GCCCAAGCCACTCTGGCAAGGGG - Intergenic
1138534483 16:57652788-57652810 GCCCACGCTACCTGGGCAGAGGG + Intronic
1139984700 16:70888728-70888750 TCCGACGCCACCCTGGCAAGGGG + Intronic
1140409759 16:74734582-74734604 GCCCACAGCAGCACGGCAGGGGG + Intronic
1141400413 16:83742243-83742265 GCCTGCGCCACCCTGGAAGGCGG - Intronic
1141673994 16:85507992-85508014 GCACTGGCCACCTCGGCAGGGGG - Intergenic
1142234362 16:88914961-88914983 CCCCACCCCGCCCCGGCAGCGGG - Intronic
1203079711 16_KI270728v1_random:1140886-1140908 CCCCACCCCACCCCTCCAGGGGG - Intergenic
1142466402 17:139915-139937 GCAGACGCCACGCAGGCAGGTGG + Intergenic
1142482698 17:228548-228570 GCCCAGGCCAACCTCGCAGGTGG + Intronic
1146163822 17:30573332-30573354 GCCCACTCCATCCAGGCCGGGGG - Intergenic
1146540092 17:33686379-33686401 TTCCACTCCACCCCAGCAGGGGG - Intronic
1147613177 17:41813128-41813150 GGCCGCGCCAGCCCGGCCGGGGG + Exonic
1148697538 17:49570243-49570265 GTCCACGCCAGCTCCGCAGGGGG - Intergenic
1148783396 17:50133912-50133934 GCGCACTTCACCCCGGCAGATGG - Exonic
1149596134 17:57865743-57865765 GCCCACCCAACCCAAGCAGGGGG + Intronic
1150282696 17:63938600-63938622 TCCCACGCCAGGCCAGCAGGCGG - Exonic
1150390857 17:64789124-64789146 GCCCACCCCTCCCCGGCTGTCGG + Intergenic
1151558759 17:74860069-74860091 GACCAAGCCAGCCTGGCAGGCGG + Intronic
1152110866 17:78357259-78357281 GCCTCCCCCACCCAGGCAGGAGG + Exonic
1152154379 17:78623120-78623142 GCCAGCACCACCCTGGCAGGGGG + Intergenic
1152387489 17:79983659-79983681 GCCCACGGCATTCCGGAAGGTGG + Intronic
1152606618 17:81294773-81294795 GCCCTCGCCTCCCCCGCAGAGGG - Intronic
1157248444 18:46072936-46072958 GCCCATTCCACCCCAGCAAGAGG + Intergenic
1161037802 19:2095403-2095425 GGCCCCCCCACCCCGGAAGGAGG - Intronic
1163371270 19:16902620-16902642 GCCCACGCCAGCAGGGCAGGTGG + Intronic
1163412899 19:17167924-17167946 CCCCGCGCCACCCCTGCAGGAGG + Exonic
1165407854 19:35641935-35641957 GCCCACGCCACCCCTGCAGCAGG + Exonic
1165698733 19:37921078-37921100 GCCCACAGCACCGCGGCAGGAGG + Intronic
1166851333 19:45762941-45762963 ACCCAAGCGACCCCGGGAGGAGG + Intronic
1167434828 19:49473382-49473404 GCCCCCACCCCCCCAGCAGGAGG - Intronic
1167456989 19:49601591-49601613 GCCCTCGCCACCCCCGCTGGTGG + Exonic
1167509927 19:49890665-49890687 GCCCCACCCACCCCGGCAGCTGG + Intronic
1167606112 19:50481920-50481942 GCCCGCGCCACCGCCACAGGAGG + Intronic
940650584 2:156436441-156436463 GCCGACTCCACCCTGGCTGGAGG + Intronic
942248102 2:174025751-174025773 GCGCACGCGGCCCCGGCAGCTGG - Intergenic
942678229 2:178450836-178450858 GCCCACGCCTCCGCGGCTGTGGG - Intronic
942971443 2:181962302-181962324 CCCCATGCCACCCCGGAAGCTGG + Intronic
946183837 2:217965693-217965715 GCTCACCACACCCCGGGAGGCGG + Intronic
948305482 2:236944198-236944220 GCCCACACCAAGCAGGCAGGGGG - Intergenic
948563215 2:238867492-238867514 GCCCACACCACCCCGGGAGCTGG - Intronic
948590943 2:239049805-239049827 GCCCACGCCCCACCAGCAGGCGG - Exonic
948645207 2:239400373-239400395 GCCCGCGCCCCCCGAGCAGGTGG - Exonic
948860688 2:240751286-240751308 CCCCACGCCACACAGCCAGGCGG + Intronic
1168758297 20:330891-330913 GCTCACACCACCCAGGCAAGGGG - Intergenic
1173752350 20:45487390-45487412 GCCCTCACCACCCCCGCTGGTGG + Intergenic
1174387941 20:50198077-50198099 CCCCACTCCACCCCTGCATGAGG - Intergenic
1174387958 20:50198127-50198149 CCCCACTCCACCCCTGCATGCGG - Intergenic
1175216442 20:57393845-57393867 GGCCAGGCCACTCAGGCAGGTGG - Intronic
1175390695 20:58625606-58625628 GGTCACGCCACCCAGGAAGGTGG - Intergenic
1176194619 20:63831412-63831434 GCCCACGCCGGCCCGGCCGCCGG + Intergenic
1176215253 20:63944848-63944870 CCCCAGGGCACCCTGGCAGGTGG + Intronic
1176215284 20:63944930-63944952 CCCCAGGGCACCCTGGCAGGTGG + Intronic
1176268245 20:64221840-64221862 GCCCAGGCCTCCCCGCCAGCCGG + Intronic
1176385338 21:6136181-6136203 TCCCACCCCGCCCCCGCAGGAGG + Intergenic
1178361515 21:31952464-31952486 GACAGAGCCACCCCGGCAGGTGG - Intronic
1179190768 21:39119950-39119972 ACCCACGCCAGCCAGGCAGCAGG + Intergenic
1179738135 21:43402071-43402093 TCCCACCCCGCCCCCGCAGGAGG - Intergenic
1180699655 22:17774384-17774406 GCCCGCGCCCCCGCGGCTGGAGG - Intronic
1180831902 22:18910869-18910891 GCCCCCGGCCCCACGGCAGGCGG + Exonic
1182422394 22:30254763-30254785 CCCCACCCCCACCCGGCAGGTGG - Intergenic
1183361879 22:37387061-37387083 GCACACGCCAGGCAGGCAGGAGG + Intronic
1183742698 22:39677619-39677641 GCCAGCGCCACCCCAGCAAGTGG + Intronic
1184280765 22:43436254-43436276 ACCCACGCCTCCACGGCAGCAGG - Intronic
1184557061 22:45239440-45239462 CCCCACCCCACCCCTGCATGAGG + Intronic
1184615126 22:45632864-45632886 CCCCATGCCACCCCTGCCGGAGG + Intergenic
1203281980 22_KI270734v1_random:136140-136162 GCCCCCGGCCCCACGGCAGGCGG + Intergenic
949892748 3:8745507-8745529 CCCCTTGCCACCCCTGCAGGTGG + Exonic
950403403 3:12788496-12788518 CCCCATGCCACCCCGGAAGCTGG + Intergenic
952966153 3:38622526-38622548 GGCCACGCCACCACCGCTGGGGG + Intronic
954036368 3:47853213-47853235 GGCCACCCCACCCTGTCAGGGGG - Exonic
961490642 3:127254847-127254869 GCCCACGCTTCCCCAGCAGGTGG + Intergenic
961634782 3:128326376-128326398 GCCCACCCCATCTTGGCAGGTGG + Intronic
968429291 4:545866-545888 CACCACGCCACCCCTGCTGGGGG + Intergenic
968518172 4:1023515-1023537 GCCCTGGACACCCAGGCAGGGGG - Intronic
968745202 4:2356397-2356419 GACCCCGCCCCCCCGGCAGTTGG + Intronic
968928424 4:3562456-3562478 GAGCAGGCCACCCCTGCAGGTGG + Intergenic
969590806 4:8121046-8121068 CCACACGCCATCCCTGCAGGTGG + Intronic
969690516 4:8701626-8701648 GCCCAGGCCACACCTGCAGGGGG - Intergenic
969694774 4:8728379-8728401 GGCCACTCAGCCCCGGCAGGAGG - Intergenic
981004275 4:139859333-139859355 GCCTATGCTACTCCGGCAGGAGG - Intronic
982157296 4:152535480-152535502 GTCCCCGCCCCCCCGGCCGGGGG + Exonic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
983936883 4:173508570-173508592 GCCCCAGCCACCGCGGTAGGTGG + Intergenic
985151010 4:186946893-186946915 GCCCAGGCCCCACCTGCAGGAGG - Intergenic
985756915 5:1724764-1724786 GCCCACGGCATCCCGGCAGCAGG + Intergenic
989475967 5:41872889-41872911 GCCCACCCCACCCCAGTAGCTGG - Intergenic
989537711 5:42582872-42582894 GCTCACCCCACCACGGCAGCTGG + Intronic
996056425 5:118988209-118988231 GCCGCCGACTCCCCGGCAGGGGG + Intronic
997266782 5:132499481-132499503 TCCCACACCATCCAGGCAGGTGG - Intergenic
997735528 5:136209950-136209972 GCCCACACAAGCCAGGCAGGGGG - Intergenic
999267507 5:150276525-150276547 GCCCACCCTACCCAGGCATGGGG + Intronic
1000014680 5:157266405-157266427 GCCCGCGCCTCCCGGGCAGAGGG - Intronic
1004335699 6:14762506-14762528 GCCCACCCCACCCCGCCCCGAGG - Intergenic
1006153342 6:32001057-32001079 GCCCACGCACTCCCGGGAGGTGG - Exonic
1006159650 6:32033794-32033816 GCCCACGCACTCCCGGGAGGTGG - Exonic
1007431723 6:41780651-41780673 GCCCGCCCCTCCCCGGCTGGTGG - Intronic
1007760185 6:44128577-44128599 GCCCAGGGGACCCAGGCAGGGGG - Intronic
1009552746 6:65120004-65120026 GCGCCCGCCACCCCGCCCGGCGG - Intronic
1014137718 6:117907851-117907873 GCGCACGCCAGCCCGGGAGGAGG - Exonic
1018241324 6:161778178-161778200 GACTATGCCACCCCAGCAGGAGG + Intronic
1018936751 6:168278827-168278849 GCCCACTCCTCTCCTGCAGGGGG + Intergenic
1019378963 7:711728-711750 GCCCCCTCCACCCCTGCCGGGGG - Intronic
1020013413 7:4818208-4818230 GCCCATGCAGCCCTGGCAGGCGG - Intronic
1020080835 7:5284846-5284868 GGCCACGCCACCCAGGAAGGCGG - Intronic
1022049973 7:26657288-26657310 GCCCACTGCTCCCCTGCAGGAGG + Intergenic
1022428061 7:30285918-30285940 GCCCCCGGCGCCCCGGCAGAAGG - Intronic
1023289527 7:38655335-38655357 GCCCAGGCCAGCCCGGAAGCTGG - Intergenic
1025198083 7:56947321-56947343 GGCCACGCCACCCAGGAAGGTGG + Intergenic
1025673866 7:63629616-63629638 GGCCACGCCACCCAGGAAGGTGG - Intergenic
1026360501 7:69598231-69598253 GCCCCCGCGGCCCCGGCCGGCGG - Intergenic
1026797493 7:73375796-73375818 GCCCACGTCACGCAGGCAGTGGG - Intergenic
1029262787 7:99314751-99314773 CCCCACCCCGCCCCGGCAGATGG + Intergenic
1032174586 7:129612399-129612421 GCCCACGCCACCCCGGCAGGAGG - Intronic
1033229512 7:139585309-139585331 GCCCACAGCAGCCAGGCAGGAGG + Intronic
1034338366 7:150337654-150337676 GCCCAGGACAGCCTGGCAGGTGG + Exonic
1034478782 7:151303901-151303923 GCCCACTCCCACCCAGCAGGAGG - Intergenic
1035312605 7:157979100-157979122 GCCCCCGCGGCCCTGGCAGGAGG + Intronic
1035862270 8:3042099-3042121 TCCCAAGCCACCCAGGCAGGAGG + Intronic
1037769448 8:21789888-21789910 TCGCACCCCACCCCGGCAGGAGG + Intronic
1037876572 8:22551659-22551681 GGCCAGGCCTCCTCGGCAGGGGG + Intronic
1038359791 8:26865226-26865248 GGCTAGGCCAGCCCGGCAGGTGG - Exonic
1039885034 8:41649801-41649823 GCCCACGCCTGCCCTGCACGAGG - Intronic
1039981278 8:42411492-42411514 GGCCACCCAACCTCGGCAGGAGG - Intergenic
1039996956 8:42541949-42541971 GCCCCCGCCGCCCCGGCAGATGG - Intronic
1047717584 8:127609937-127609959 GCCCACGCCATACAGGTAGGTGG + Intergenic
1048252912 8:132882073-132882095 GCCCACAGCAGCCTGGCAGGGGG - Intronic
1049009194 8:139875943-139875965 CCCCAGGCCACCCTGGCAGCTGG - Intronic
1049194512 8:141308102-141308124 GCCCCCGCGGCCCCGGCCGGAGG - Intronic
1049612091 8:143560513-143560535 CCCCACGCCACCGGGGGAGGTGG - Intronic
1049653732 8:143788710-143788732 GCCCAGGCCACCCAGGCCGCTGG - Intergenic
1049720633 8:144113901-144113923 CCCCAGGCCACCACGGGAGGTGG + Intronic
1049805096 8:144535107-144535129 GCCCCCCTCACCCTGGCAGGCGG - Intronic
1050302350 9:4272472-4272494 GCCCAAGCACACCCGGCAGGAGG - Intronic
1052841046 9:33290975-33290997 GCCCACGCCACCACTCCAGGCGG - Intronic
1053011767 9:34637687-34637709 GCCCACTGCATCCCGGCGGGCGG + Exonic
1053803308 9:41777598-41777620 GAGCAGGCCACCCCTGCAGGTGG + Intergenic
1054141955 9:61537526-61537548 GAGCAGGCCACCCCTGCAGGTGG - Intergenic
1054461714 9:65468704-65468726 GAGCAGGCCACCCCTGCAGGTGG - Intergenic
1057018975 9:91681168-91681190 CCCCACCCCACCCCAGCAGGAGG + Intronic
1057228889 9:93306897-93306919 GCCCACGCCCGCCCGGCCGCGGG - Intronic
1059483708 9:114611520-114611542 GCCGCCGCCACCCCGGGACGCGG - Exonic
1060480894 9:124016217-124016239 CCCCACCCCACCCCGGCGCGAGG - Intronic
1061272183 9:129549956-129549978 GCCCACGCGACCGCTCCAGGCGG + Intergenic
1062005696 9:134237473-134237495 GCCCACCCCACCACGGCAGCAGG - Intergenic
1187419625 X:19122763-19122785 GCCCACCCCACCGCAGCCGGGGG + Intergenic
1187507257 X:19887739-19887761 GGCCGCGCGTCCCCGGCAGGCGG - Intergenic
1190325582 X:49205078-49205100 GCCCTCCCCTCCCCAGCAGGAGG - Exonic
1190597851 X:52065068-52065090 GCCCAGGCCAGGCAGGCAGGAGG + Intronic
1190610973 X:52189005-52189027 GCCCAGGCCAGGCAGGCAGGAGG - Intronic
1193258695 X:79380018-79380040 GCCCACGCCACCCAGGCCTTGGG + Intergenic
1193759034 X:85442275-85442297 GCCCACGCCCCCCAGTCATGTGG - Intergenic
1194321918 X:92459821-92459843 CCCCATGCCACCCCGGAAGCTGG - Intronic
1196586512 X:117435508-117435530 GCCCAGGCCACCCCTGCTAGGGG - Intergenic
1200047365 X:153409971-153409993 GCCCAGGCCACTCCGACACGAGG - Intergenic
1200084249 X:153595575-153595597 GCCCACGCCACACCCACAGCAGG + Intronic
1200089318 X:153626990-153627012 GCCCAGGCCACTCCGACACGAGG + Intergenic