ID: 1032177998

View in Genome Browser
Species Human (GRCh38)
Location 7:129648690-129648712
Sequence CCTTACATGGTGAGGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032177998 Original CRISPR CCTTACATGGTGAGGGAGTC AGG (reversed) Intronic
902404912 1:16177306-16177328 CCTTCCATGGAGAGGAATTCTGG + Intergenic
902488797 1:16765625-16765647 CCTTCCAGGGTTAGGGAGACAGG + Intronic
903572864 1:24319243-24319265 CCTTCCTTGGTGAGGGGGTGGGG - Intergenic
903916880 1:26771310-26771332 CCTTACCAGGAGAGGGAGGCTGG - Exonic
904203588 1:28837814-28837836 CCTTACATGAAGAGAGAGTTGGG - Intronic
904684369 1:32249938-32249960 GCTTACATTGCAAGGGAGTCTGG + Intergenic
905339105 1:37266184-37266206 CCTGCCATGGTGAGGTATTCAGG + Intergenic
906940428 1:50250958-50250980 CTTTAGATGGTGAGGGTGGCAGG + Intergenic
909601489 1:77466058-77466080 CGGGCCATGGTGAGGGAGTCGGG - Intronic
910252132 1:85208802-85208824 TTTTAGATGGTGGGGGAGTCAGG - Intergenic
911050488 1:93666847-93666869 TCTCACATGTTGATGGAGTCTGG - Intronic
912747094 1:112253969-112253991 CCTCAGCTGGTGATGGAGTCAGG - Intergenic
919759931 1:201091554-201091576 CCCTACCTGGTGAAGGAGCCCGG - Intronic
923531639 1:234816899-234816921 CCTTCCAGGGTTAGGGAGACAGG - Intergenic
923965582 1:239134997-239135019 CCTTACTGGGTCAGGGGGTCAGG + Intergenic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1063955221 10:11259212-11259234 CCTCACATGGTGCTGAAGTCAGG - Intronic
1064358975 10:14646243-14646265 AATTATATAGTGAGGGAGTCTGG + Intronic
1069537366 10:69264829-69264851 CATTGCTTGGTGTGGGAGTCAGG + Intronic
1071115507 10:82214407-82214429 CCTGATATGGTGAGGAAGGCAGG + Intronic
1071433559 10:85625688-85625710 ATTGACATGGTGAGGGAGTCTGG + Intronic
1075103009 10:119519216-119519238 TCTTACAAGGTGAGGGAAGCGGG - Intronic
1076069483 10:127475431-127475453 CCTTACATGGTGAGGAACTGAGG + Intergenic
1076436282 10:130445143-130445165 CCTAACCTGCTGGGGGAGTCTGG + Intergenic
1080781070 11:35430684-35430706 CCAGACATGGTGGGGGAGACAGG + Intergenic
1080908197 11:36567940-36567962 CCCTCCATGGTGGGGGAGGCTGG + Intronic
1081341894 11:41938116-41938138 CCTCACATGGTCATGGAGTCTGG + Intergenic
1082769424 11:57195333-57195355 CCTTCCATGTTGAGGGGGTTGGG - Intergenic
1082869669 11:57932395-57932417 TCTTGCTTGGTGAGGGTGTCTGG + Intergenic
1083170671 11:60922409-60922431 CCTTCCCTGGTGAGGCAGGCTGG - Exonic
1084237333 11:67796559-67796581 CCCCACATGGTGTGGGAGTGTGG + Intergenic
1085621023 11:78038112-78038134 CCTTACATGGGAAGGGCCTCTGG - Intronic
1089356673 11:117858407-117858429 CCTGACATGGAGAGGGAGTGAGG - Intronic
1090351449 11:126110994-126111016 CCTCACATGGTAAGGGAGGCAGG + Intergenic
1091028959 11:132166735-132166757 CCTTTCACGATGAGTGAGTCTGG + Intronic
1092391030 12:8079505-8079527 ACTTACATGGTGAGGGAAAGGGG + Intergenic
1093033906 12:14315048-14315070 CCTTAAAGGGTGAGGGATGCTGG + Intergenic
1095740875 12:45605289-45605311 CCTTACATAGTTAGGGATACTGG + Intergenic
1102204604 12:111081970-111081992 CCTCTCAGGGTGAGGGAGCCGGG - Intronic
1102679297 12:114679862-114679884 CCTTAGATGGTGAGGGTGGGGGG - Intronic
1103338079 12:120204874-120204896 GCTTCTATGGTGAGGGAGACTGG + Intergenic
1112211336 13:97380597-97380619 TCTTACATGGTGAGGGGGACAGG + Intronic
1112976326 13:105323038-105323060 CTTTACATGGTGAAGAAGTAAGG + Intergenic
1114183502 14:20383645-20383667 CTGTACATGGAGAGGAAGTCAGG + Intronic
1120883180 14:89430988-89431010 CCTTAAATGGAGATGGAGTTTGG - Intronic
1122805889 14:104256811-104256833 CCAAGCATGGTGAGGGATTCTGG + Intergenic
1126419658 15:48457916-48457938 CCTTATATGATAAGGGAGGCAGG - Intronic
1128801553 15:70500344-70500366 CCTTTCTTGGTGAGGGAGAGGGG - Intergenic
1129287553 15:74538357-74538379 ACTTACATGATAAGGAAGTCAGG + Intergenic
1132204656 15:99978053-99978075 CCACACGTGGTGAGGGAGGCAGG + Intronic
1134257389 16:12623447-12623469 CTTTACATAGAGAGGGAGGCAGG - Intergenic
1135992255 16:27225203-27225225 CCTGAGAAGGAGAGGGAGTCTGG - Exonic
1137500074 16:49004102-49004124 CCTTACATGGTCACGGTTTCTGG + Intergenic
1138948983 16:61887572-61887594 CCTTACATGAAGAGGAAATCCGG - Intronic
1145040190 17:19572227-19572249 CAGTACAGGGTGAGGGAGACAGG - Intronic
1147586600 17:41656755-41656777 CCTTCCATGGGGAGGGAGGAAGG + Intergenic
1148753093 17:49957183-49957205 CCTTGCATGCTGAGGCACTCAGG - Intergenic
1150007222 17:61477236-61477258 CCTTCAATGGGGAGGGCGTCTGG + Intronic
1151102862 17:71575518-71575540 TCTTGCATTGTGAGTGAGTCAGG - Intergenic
1152378034 17:79928714-79928736 CCATCCATGGTGGGGGAGGCTGG - Intergenic
1152895052 17:82906093-82906115 GATTACATGGTGAGGGGATCAGG - Intronic
1153614887 18:6925259-6925281 CCTTACCTTGTTTGGGAGTCAGG + Intergenic
1155844047 18:30683266-30683288 CCTTACATGGTGGGGCAATTTGG - Intergenic
1156969418 18:43137230-43137252 ACCTACATGGTGAAGGAGACAGG - Intergenic
1158014736 18:52770946-52770968 CCTCACATGCTGAGGAAGACGGG + Intronic
1158491140 18:57910743-57910765 CCAAACATGGTGAGGAACTCTGG + Intergenic
1159954187 18:74507800-74507822 CCTGACAAGGAGAGGGAGGCCGG - Intronic
1163452996 19:17390329-17390351 CTTTACATGGTGGGGGAGAGAGG + Intergenic
1164527475 19:29022625-29022647 CCTTGCTTGGGGAGGAAGTCAGG - Intergenic
1166354232 19:42217529-42217551 CCTTGCAGGGCGAGGGGGTCGGG - Intronic
1166510643 19:43406572-43406594 ACTAACCTGGTGGGGGAGTCGGG + Intronic
1167732536 19:51269218-51269240 ACTTACATTCTAAGGGAGTCAGG - Exonic
1168084968 19:54038843-54038865 CCTTACATAGTGAAAGAGACTGG - Intergenic
925114908 2:1370147-1370169 CCCTGCTTAGTGAGGGAGTCGGG - Intergenic
925555678 2:5129392-5129414 CCAGACATGGTGAGAGAGTCAGG + Intergenic
927885084 2:26713320-26713342 CCAGAAATGGTGAGGGAGTCAGG + Intronic
928285599 2:29987615-29987637 CCTTAAAGGGTGAGGAAGTCAGG - Intergenic
931632933 2:64317362-64317384 CTTTCCAAGGTGAGGGAGTGAGG + Intergenic
935848862 2:107197374-107197396 CCTTACACAGTGAGGGGGCCTGG - Intergenic
936944798 2:117920722-117920744 CCTACTATGGTGAGGGAGTGGGG + Intronic
940210799 2:151254698-151254720 ACTTAGATGGTGAGGAAGTTGGG - Intronic
942106238 2:172636340-172636362 CATTACATGGTGAGAGAGGGCGG + Intergenic
1170014950 20:11769862-11769884 CATCACAGAGTGAGGGAGTCCGG - Intergenic
1175154128 20:56958048-56958070 GCTAACATGGTGGGGGAGTGGGG + Intergenic
1175763104 20:61574293-61574315 CCTTGCATGGTGAGGCACACAGG - Intronic
1181498167 22:23299893-23299915 GCCTTCATGGTGAGGGGGTCGGG + Intronic
1182448530 22:30404106-30404128 CCTCTCATGGTGGGGGAGTTGGG - Intronic
955803192 3:62706929-62706951 TATTACATAGTGAGGAAGTCTGG - Intronic
956037914 3:65115640-65115662 GCTTACCTGGTGAGTGAGCCAGG - Intergenic
957193604 3:77040083-77040105 TCCTACGTGGTGAGGGAGGCAGG - Intronic
958667314 3:97158196-97158218 CTTTACATGATAAGGGAGTAGGG + Intronic
959294266 3:104515163-104515185 CCATAGATGGTGGGGGAGTGTGG - Intergenic
961047835 3:123721642-123721664 CCTTACATGCTGGGGGACCCTGG - Intronic
961079480 3:124013789-124013811 CTTGGCATGGTGAGGGAGTGAGG + Intergenic
961270122 3:125681922-125681944 CCTTACATGCTGGGGGACCCTGG + Intergenic
962482384 3:135808929-135808951 CCTTTCAGGGTGAAAGAGTCTGG + Intergenic
968292136 3:197547121-197547143 CCTCAAATGGTGAGGGAGCGGGG - Intronic
971253675 4:24994418-24994440 CCTTCCCTGTGGAGGGAGTCCGG + Intergenic
983875834 4:172873557-172873579 CCATAGATCGTGAGGGAGACAGG + Intronic
985258302 4:188091410-188091432 TGTAAGATGGTGAGGGAGTCTGG + Exonic
986982950 5:13469944-13469966 CCTTTTATGGTGAGAGAGTTGGG - Intergenic
987089191 5:14496322-14496344 CCTCACATAGTTAGGGAGACTGG + Intronic
987834933 5:23147622-23147644 CTTTACATGGTGAGGAAAACAGG - Intergenic
991369448 5:65903088-65903110 CCTTACTTGGTGTGTTAGTCAGG - Intergenic
991651915 5:68864247-68864269 CTTTTCCTGGTGAGGGACTCAGG - Intergenic
995908068 5:117150379-117150401 GCTTACAGGGTGAGGGAATATGG - Intergenic
996508587 5:124294217-124294239 CCTCACATGTTGAGGGAGGGAGG + Intergenic
998107492 5:139477616-139477638 CGTTACAGGCTGAGGGAGTGGGG - Intronic
1002087372 5:176784672-176784694 CCCTACTTGGGGAGGGAGTTGGG + Intergenic
1005492400 6:26358973-26358995 CCTCACATTGTGAGGGGGCCTGG + Intergenic
1009192133 6:60641907-60641929 CCTAACATGCTTAGGGACTCAGG + Intergenic
1015979240 6:138822253-138822275 CATTACATGGGGAAGGAGGCCGG + Intronic
1017919336 6:158857649-158857671 AAGTACATGGTGAGGGAGGCAGG - Intergenic
1018838795 6:167504552-167504574 CTTTAGAGGGTCAGGGAGTCAGG + Intergenic
1022127470 7:27372274-27372296 CATTACATGGTGAGGGAGGAAGG + Intergenic
1028892052 7:95999425-95999447 CCTGACATAGTGAGGGTTTCAGG - Intronic
1031312371 7:120215020-120215042 CCTTACCTGGTAAGCGGGTCTGG + Intergenic
1032177998 7:129648690-129648712 CCTTACATGGTGAGGGAGTCAGG - Intronic
1033004396 7:137545894-137545916 ACTCACATGGTGAAGGAGCCGGG + Intronic
1033402941 7:141044212-141044234 CCCTAGAGGGTTAGGGAGTCAGG + Intergenic
1034949835 7:155289838-155289860 CCTCACATGGTGAAGGGGCCAGG + Intergenic
1035201943 7:157273320-157273342 ACTTACATGGTGGGGGAGAAAGG - Intergenic
1035307661 7:157943570-157943592 TCCTCCATGTTGAGGGAGTCTGG - Intronic
1037442729 8:18933297-18933319 CCTTATTTGGTGAGTGAGTTTGG - Intronic
1037945854 8:22988922-22988944 CCTTACATGGTGAGGTAAGAGGG - Intronic
1040681052 8:49809746-49809768 CCTCACATGTTGAGGGAGGGAGG + Intergenic
1047178763 8:122567434-122567456 ACTAACATGGGGAGGGAGTTGGG - Intergenic
1047256168 8:123215066-123215088 CCTTAACTGATGCGGGAGTCGGG - Intergenic
1047433752 8:124817027-124817049 CCTTAAATGATGAGGGAATATGG + Intergenic
1048886749 8:138915119-138915141 CCTGACATGGTGAGGGTGGTGGG - Intergenic
1048953161 8:139512751-139512773 CCTTGGAAGCTGAGGGAGTCAGG - Intergenic
1049352007 8:142169634-142169656 CCCTCCATGTTGAGGGTGTCTGG - Intergenic
1049352037 8:142169733-142169755 CCCTCCATGTTGAGGGTGTCAGG - Intergenic
1049352052 8:142169783-142169805 CCCTCCATGCTGAGGGTGTCAGG - Intergenic
1049352069 8:142169833-142169855 CCCTCCATGCTGAGGGTGTCAGG - Intergenic
1049352086 8:142169883-142169905 CCCTCCATGCTGAGGGTGTCAGG - Intergenic
1049352103 8:142169933-142169955 CCCTCCATGTTGAGGGTGTCAGG - Intergenic
1049415204 8:142491881-142491903 CCTGACAGGGAGAGGGAGGCAGG + Intronic
1053389400 9:37723465-37723487 CCTGACATGGTGAGGAGGTTAGG + Intronic
1060177885 9:121510883-121510905 CTTTACATGGTGGGGGAGTTTGG - Intergenic
1186652039 X:11571516-11571538 CCTTACATGGGGAGATAATCTGG + Intronic
1192234504 X:69287135-69287157 CCTGTCATGGTGAGGGACTGAGG - Intergenic
1197490291 X:127107882-127107904 CCTGTCATGGTGTGGGAGGCTGG + Intergenic
1202039090 Y:20664221-20664243 GCTTACATAGTGATGTAGTCTGG - Intergenic