ID: 1032182467

View in Genome Browser
Species Human (GRCh38)
Location 7:129692093-129692115
Sequence CCTGCCACCGGGAGGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032182467_1032182475 15 Left 1032182467 7:129692093-129692115 CCTGCCACCCTCCCGGTGGCAGG 0: 1
1: 0
2: 0
3: 22
4: 317
Right 1032182475 7:129692131-129692153 TCTGAAATGTACCCTGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032182467 Original CRISPR CCTGCCACCGGGAGGGTGGC AGG (reversed) Intronic
900121252 1:1049544-1049566 CCTGCCACCAGGAGGGACACCGG - Exonic
900381367 1:2385653-2385675 CTTGGCACTGGGGGGGTGGCGGG + Intronic
901435545 1:9245326-9245348 CAGGCCTCCGGGAGGCTGGCAGG + Exonic
901449256 1:9326081-9326103 TCTGTCCCCAGGAGGGTGGCTGG + Intronic
901505240 1:9680989-9681011 CCTGCCACAGCGTGGTTGGCAGG + Intronic
902878409 1:19354824-19354846 CCTGCCACCTGGGGAGTGGGTGG - Intronic
903216413 1:21845953-21845975 CCTGGGACCGTGTGGGTGGCGGG + Intronic
903783263 1:25836855-25836877 CCTGCCACTTGGAGGGTGTTGGG - Intronic
904542066 1:31239811-31239833 CCTGCCCCGGGGCGGCTGGCGGG + Intergenic
904599851 1:31667370-31667392 GCTGCCAAGGGGAGGGTGCCAGG - Intronic
904840829 1:33370817-33370839 CCTGACACTGGGAGGATGACAGG + Intronic
905043061 1:34976411-34976433 GATGCCACTGGGAGGGTGACAGG + Intergenic
905206195 1:36344091-36344113 CCTGCCTCCCGGGGGGTGGGGGG - Intronic
905627310 1:39497746-39497768 CCTGCCACGGGGTGGGGGGCAGG - Intronic
906971643 1:50520731-50520753 CCAGCAACTGGGAGGGAGGCAGG + Intronic
909550482 1:76894347-76894369 GCTGCCACAGGGGTGGTGGCAGG - Intronic
909684015 1:78325476-78325498 CCTGCCACCAGGTGGCTGGCTGG + Intronic
912691075 1:111805025-111805047 CCTCCCAGCTGCAGGGTGGCGGG + Intronic
913323256 1:117605578-117605600 CCTGCCCCCAGGAGTGAGGCGGG - Intergenic
915167852 1:153958516-153958538 GCTGGTACTGGGAGGGTGGCAGG - Exonic
915360953 1:155285970-155285992 CAGGCCTCAGGGAGGGTGGCAGG + Intronic
918998082 1:191789015-191789037 GCTGCTACCTGGAGGGTGGAGGG + Intergenic
922164463 1:223103342-223103364 CCTGCTTCCTGAAGGGTGGCTGG + Intergenic
922315027 1:224434572-224434594 GCTGCCTCCGGGAGGGGGGGGGG - Intronic
922801030 1:228364881-228364903 CCTGCCACAGGCAGGGTGGGTGG - Intronic
1064869959 10:19926349-19926371 TCTGCCATAGGGTGGGTGGCAGG + Intronic
1067166812 10:43871699-43871721 ACTGCCCCCGGGACAGTGGCTGG + Intergenic
1067832289 10:49617080-49617102 TCTGCCACCCGAAGGCTGGCTGG - Intronic
1068367242 10:56067654-56067676 CCTGCCATGATGAGGGTGGCTGG + Intergenic
1070476954 10:76838179-76838201 CCTGTCATGGGGAGGGGGGCAGG + Intergenic
1075071026 10:119319975-119319997 CCTGCTCCCGGGAAGGAGGCGGG - Intronic
1075419180 10:122288237-122288259 CCTGCCACGGGGTGGATGGCAGG + Intronic
1075522472 10:123151201-123151223 TCTGCCACCGGCCGGGTAGCTGG - Intergenic
1076572154 10:131439891-131439913 CCTCCCACCGGGAGAGCGGCTGG + Intergenic
1076629775 10:131845614-131845636 GAGGCCACGGGGAGGGTGGCGGG - Intergenic
1076629795 10:131845701-131845723 GAGGCCACGGGGAGGGTGGCGGG - Intergenic
1076853591 10:133104732-133104754 CCAGACACCGGGGGGGCGGCTGG - Intronic
1078195378 11:9132872-9132894 CTTGCCACCAGGTGGCTGGCTGG - Intronic
1078699587 11:13668381-13668403 CCTGCGGCCGGGAGGCTCGCGGG - Intergenic
1078822071 11:14892266-14892288 CCTGCCAATGGGAGTATGGCAGG - Intergenic
1080664372 11:34322791-34322813 CCAGCTACTGGGAGGGTGGGGGG - Intronic
1083782009 11:64923609-64923631 TCTGCAACCGGGAGGATGGCTGG + Intronic
1084065341 11:66700797-66700819 TCTGCCTCAGGCAGGGTGGCCGG + Exonic
1085084330 11:73656649-73656671 CCTGGCATGGGGTGGGTGGCAGG + Intronic
1085318267 11:75559120-75559142 CCTGGCACGTGGAGGCTGGCTGG - Intergenic
1085521802 11:77143532-77143554 CCTGCCCCGGAGAAGGTGGCTGG + Intronic
1085705964 11:78787013-78787035 CCTGCCGCTGCGAGGATGGCTGG - Exonic
1088250746 11:107858988-107859010 CCTGGCACCTCCAGGGTGGCAGG + Exonic
1089456664 11:118629791-118629813 CCTGGCACAGGCAGAGTGGCAGG + Intronic
1089982066 11:122780710-122780732 CCTGCAGGCGGGCGGGTGGCAGG + Intronic
1090597436 11:128334827-128334849 CCTGACAACGTGGGGGTGGCGGG + Intergenic
1091178046 11:133579416-133579438 CATGCCAGCGTGGGGGTGGCCGG - Intergenic
1091588959 12:1831711-1831733 CCTGCCAATGGGAGAGAGGCTGG + Intronic
1091746242 12:2994933-2994955 CCTGCCACAGGGCGGGTAGATGG - Exonic
1092138622 12:6167309-6167331 CCTGGGCCCTGGAGGGTGGCAGG - Intergenic
1092204494 12:6606983-6607005 CGTCCCACCGGGAAGGGGGCCGG + Intronic
1093268566 12:17028666-17028688 CCTGCCAGCGCCAGAGTGGCTGG + Intergenic
1094375387 12:29783691-29783713 CCCGCCGCCGGGAGGGTGTGCGG + Exonic
1094427022 12:30326819-30326841 CCTGCCATCAGGTGGCTGGCTGG + Intergenic
1098291136 12:68957839-68957861 CCTGTCAGGGGGTGGGTGGCTGG - Intronic
1098819125 12:75207687-75207709 GCCGCCACCGGGATGGTCGCTGG + Exonic
1101642872 12:106601227-106601249 ACTGCCACCGGCAGGGAGCCAGG + Exonic
1101778691 12:107816552-107816574 TCTGCCAGCAGGAGGCTGGCTGG - Intergenic
1102502045 12:113359365-113359387 CCTGGCACTGGAAGGGAGGCAGG - Intronic
1103120778 12:118377516-118377538 CCTGTTTCCGGGAGGGGGGCGGG - Intronic
1104014701 12:124954056-124954078 CCTGCCCGTTGGAGGGTGGCGGG - Intronic
1106363993 13:29059976-29059998 CCTGCCACTGGGAGCCAGGCAGG - Intronic
1106790931 13:33154144-33154166 CCATCCACAGGGAGGGTGTCGGG + Intronic
1106885583 13:34181392-34181414 CCTTCTACCGGGAGGGAGGTAGG + Intergenic
1107567222 13:41617637-41617659 CCTGTCACAGGGCGGGGGGCTGG - Intronic
1107678823 13:42825966-42825988 ACTGCCTGTGGGAGGGTGGCAGG - Intergenic
1109075093 13:57824067-57824089 CCTGCCACCTGCAGCATGGCTGG - Intergenic
1112414398 13:99192244-99192266 CCTGTCACCGGGTGTGTGACCGG - Intergenic
1113604163 13:111593494-111593516 CCTGTCATGGGGTGGGTGGCTGG - Intronic
1114527384 14:23375376-23375398 CCTGGGACCGTGAGGGAGGCAGG - Intronic
1116794393 14:49374198-49374220 GCTGCCACAGTTAGGGTGGCTGG + Intergenic
1116905204 14:50396989-50397011 CCTGCAGCCGGGAGGGCGGCCGG - Intronic
1119265408 14:73261071-73261093 GCTGCCACGGGGAGGATGGCAGG - Intronic
1119788004 14:77327138-77327160 CCTGACCCTGGGAGGGTGGGTGG + Intronic
1120167815 14:81220161-81220183 CCGGCCGCCGGGAGGGAGGGCGG - Intronic
1121347897 14:93149665-93149687 CCTGCCGGGGTGAGGGTGGCGGG - Intergenic
1121583007 14:95044846-95044868 CATGCCACTGGGAGGAGGGCGGG + Intergenic
1122156860 14:99755206-99755228 CCTGTCACCGGCTGGGTGCCTGG - Intronic
1122597263 14:102902341-102902363 CCTCCCACCTGGATGGTGGCAGG - Intronic
1122779642 14:104138347-104138369 CCTGCCCCGGGGAGGGGCGCTGG - Intergenic
1122876068 14:104665958-104665980 GCTGGCACCGGGCTGGTGGCAGG + Intergenic
1125394530 15:39232609-39232631 CCTGCCAGAGGCAGGGTTGCAGG + Intergenic
1127809734 15:62554201-62554223 CCTGCCACAGTGAGGGGGGCAGG - Intronic
1128239855 15:66094424-66094446 CCTGCCACTGCGAGCCTGGCTGG - Exonic
1128249014 15:66151950-66151972 CCTGCCATGGGGCGGGGGGCAGG + Intronic
1129434427 15:75526846-75526868 CCTGCCACCAGGATGCTGTCAGG + Intronic
1131021038 15:89099035-89099057 CCTGGCACAGGGAGGGTCCCTGG + Intronic
1131548878 15:93339307-93339329 ACTGCCAGGGGGAGGGTGACAGG - Intergenic
1131825776 15:96321869-96321891 CCTGACACCGAGTGGGTGGGAGG + Intergenic
1132481769 16:169863-169885 CCTGCCAGAGGGTAGGTGGCTGG + Intergenic
1132482637 16:174120-174142 CCTGCCAGAGGGTAGGTGGCTGG + Intergenic
1132730087 16:1356836-1356858 ACTCCCGCTGGGAGGGTGGCTGG - Intronic
1133222845 16:4326576-4326598 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
1133628454 16:7594123-7594145 CCTGTCACGGGGTGGGGGGCTGG - Intronic
1134571992 16:15298983-15299005 CCTTCCACCTGGAGGTTAGCAGG + Intergenic
1134730389 16:16457060-16457082 CCTTCCACCTGGAGGTTAGCAGG - Intergenic
1134937042 16:18254836-18254858 CCTTCCACCTGGAGGTTAGCAGG + Intergenic
1136271780 16:29152865-29152887 CCTGCGACCTGGAGGGTTGGTGG - Intergenic
1137034793 16:35560719-35560741 CCTGCCACCAGAAGGTTTGCTGG + Intergenic
1138528097 16:57620373-57620395 CCTAGCACCGGGAAGCTGGCAGG + Intronic
1139509080 16:67416241-67416263 GCTGCCCCGGGGAGGGTGGAAGG - Exonic
1141265755 16:82495465-82495487 AGTGCCAGGGGGAGGGTGGCAGG + Intergenic
1141287954 16:82690193-82690215 CATGACCCCGGGTGGGTGGCTGG + Intronic
1141806417 16:86344682-86344704 CCTGCCAAAGGGAAGGAGGCAGG - Intergenic
1142035634 16:87860909-87860931 CGTGCCTCCGGGAGTGTGGGAGG - Intronic
1142075445 16:88115025-88115047 CCTGCGACCTGGAGGGTTGGTGG - Intronic
1142159268 16:88548248-88548270 CCTTCCCCCGGGAGGGTGACAGG - Intergenic
1142198831 16:88751410-88751432 TCTGCTTCCGGGAGGGTGGAAGG - Intronic
1142767067 17:2070839-2070861 GCTGCCACCTAGAGGGTGACAGG + Intronic
1143767069 17:9144877-9144899 CCTGCCTCCTCGAGGGTGGGAGG + Intronic
1144574496 17:16420360-16420382 CCTCCCACTGGAAGGATGGCTGG + Intronic
1144959353 17:19036129-19036151 CCTGGCACGGGGTGGGAGGCTGG - Intronic
1144975806 17:19138395-19138417 CCTGGCACGGGGTGGGAGGCTGG + Intronic
1144993344 17:19249285-19249307 GCTGGCACCCTGAGGGTGGCTGG + Intronic
1146828795 17:36048156-36048178 CCTGCCAGATGGAGGGTGGTTGG - Intergenic
1147160775 17:38568344-38568366 CCTGCTCCTGGGAGGGTGGAGGG - Intronic
1147917411 17:43896942-43896964 CCTGCCCCAGGGAGTGTGGAAGG - Intronic
1148997676 17:51725485-51725507 CCTGCCACAGAGAGGGTTACTGG - Intronic
1149896342 17:60431479-60431501 CCTGCCACTTAGAAGGTGGCTGG - Intergenic
1150237950 17:63608218-63608240 CCTGCATCCGAGAGGGTGTCGGG - Exonic
1151968557 17:77445134-77445156 CCTGCCAACCCAAGGGTGGCAGG + Intronic
1153599425 18:6764587-6764609 GCTGCCTCAGGGAGGCTGGCAGG - Intronic
1154252416 18:12755695-12755717 CCTGCCACCAGGTAGCTGGCTGG + Intergenic
1154374279 18:13796430-13796452 CTTGCCACAGTGAGGGTGACTGG + Intergenic
1154501884 18:15001369-15001391 CCTGCCACGGGTGGGGTGGAGGG - Intergenic
1155003078 18:21704934-21704956 CCGGCCACCGGGAGGGCGGGCGG + Intergenic
1156255091 18:35387273-35387295 CCTGCCACCAGGTGGCTGGCTGG - Intergenic
1157276214 18:46312759-46312781 CCTGCCCAGGGGAGGCTGGCAGG + Intergenic
1157537662 18:48471902-48471924 CCTGCCACGGGGTGGTTGACAGG + Intergenic
1157597130 18:48870783-48870805 CCTGCCCCTGGGAGTGGGGCCGG + Intergenic
1158343826 18:56494428-56494450 CCTGGCACGGGGAGGGTCGAAGG + Intergenic
1160846977 19:1170373-1170395 CCAACCCCCGGGAGGTTGGCCGG - Intronic
1160904844 19:1447174-1447196 CCCGCCGCCGGCTGGGTGGCCGG - Intronic
1161646561 19:5456655-5456677 CCAGCCTCCGGGAGCGTAGCTGG - Exonic
1162951586 19:14074505-14074527 CCTGGCACCGGAGGGGTGGGGGG - Intronic
1162978285 19:14221605-14221627 CATGCCACCGCCAGGGTGTCAGG - Intergenic
1163126244 19:15245741-15245763 CCTGCCACCAGATGGGAGGCCGG + Intronic
1163287148 19:16355899-16355921 CCTGCAAGCTGGAGGGAGGCAGG + Intronic
1163302620 19:16457489-16457511 CTTGCCACGGGGAGGGAGGGAGG + Intronic
1163753367 19:19091963-19091985 CTTGAGACAGGGAGGGTGGCGGG + Intronic
1164186154 19:22871540-22871562 GCTGCCCCCGGGAGGGAGGTGGG - Intergenic
1164669183 19:30063243-30063265 TCTCCCACCTGGAGGGTGGCGGG - Intergenic
1165105103 19:33464522-33464544 CCTGCCCACGGGTGGGTGACAGG + Intronic
1165448298 19:35868739-35868761 CCCGCCATCGGGAGCCTGGCCGG + Exonic
1166352075 19:42203989-42204011 CCTGTCCCTGGGAGGGTGGGGGG + Intronic
1166663384 19:44661912-44661934 TCTGGCACAGGGAGGGAGGCTGG - Exonic
1166873919 19:45885964-45885986 CCTGCCTTCGCGAGGGAGGCGGG - Exonic
1166990569 19:46690246-46690268 GCTGCCATCTGGAGGGTGGGTGG - Intronic
1167272238 19:48511915-48511937 CCTGTCACAGGAAGGGTGGGAGG + Intronic
1168280273 19:55302013-55302035 CCTGCCCCCGGTGGGGTGGGCGG + Intronic
1168398200 19:56066622-56066644 CCTGCTCCCGGGAGGGTCTCAGG - Intergenic
928493484 2:31807491-31807513 CCTGCCAGGGGGTGGGTGGAGGG + Intergenic
932494615 2:72140226-72140248 CCAGGCAGCGGGAGGGTGGGCGG - Intronic
933356627 2:81218319-81218341 CCTGGCAGCAGGAAGGTGGCGGG - Intergenic
934561378 2:95315245-95315267 CCTGCCACCTGGTGGCTGGCTGG + Intronic
935334218 2:102000337-102000359 CCTGCCAGCAGCAGGGTGGTGGG - Intronic
935571137 2:104661135-104661157 CCTGCCTCTGGGAGGGTGGAGGG - Intergenic
935622759 2:105143913-105143935 ACTGCGCCCAGGAGGGTGGCCGG + Intergenic
936349760 2:111703779-111703801 CCTGGCACAGGGAAGGTGCCGGG - Intergenic
936911725 2:117600742-117600764 CCTGCCAGTGGGTGGGGGGCTGG + Intergenic
937901881 2:127025644-127025666 CCCCCCACCGGCAGGGTGGAAGG - Intergenic
942937994 2:181581713-181581735 CCTGCCACCAGGTGGCTGGCTGG + Intronic
944615078 2:201451686-201451708 CCAGCCCCGGGGAGGGAGGCGGG + Exonic
947573944 2:231257615-231257637 CCAGTCACAGGGAGGGTAGCAGG - Intronic
947877537 2:233477667-233477689 CCTGGCACAGGGCTGGTGGCAGG - Intronic
1168803944 20:662126-662148 GCGGCCAACGGGCGGGTGGCTGG + Exonic
1169185559 20:3614124-3614146 CCTGTTTCTGGGAGGGTGGCGGG + Intronic
1169847022 20:10005042-10005064 CCTGCCATGGGGAGGGTGAGGGG + Intronic
1170578712 20:17682346-17682368 CCAGCGACCGGCAGAGTGGCGGG - Intergenic
1171293041 20:23993576-23993598 CCTGACACTGCGAGGGTGGGGGG - Intergenic
1171402317 20:24882790-24882812 CCTGCCACAGGGCTGGGGGCTGG - Intergenic
1171533385 20:25866559-25866581 CCTGGGACCCGGGGGGTGGCAGG + Intronic
1171866669 20:30490899-30490921 CCTGTCACCGGCAGGCAGGCAGG - Intergenic
1172630513 20:36375196-36375218 GCTCCCACCTGCAGGGTGGCAGG - Intronic
1172885949 20:38231013-38231035 CCTGCCATCGGGGGGTTGTCAGG - Intronic
1173837985 20:46138303-46138325 CCTGCCCCAGTGAAGGTGGCAGG + Intergenic
1173911421 20:46673760-46673782 CCAGGCACTGGGAGTGTGGCAGG - Intronic
1174096828 20:48096424-48096446 CCAGGCACTGGGAGGGAGGCTGG - Intergenic
1174596827 20:51690690-51690712 CCTGTCACCGGGAGTGTGTAAGG - Intronic
1175715531 20:61252487-61252509 CCGGGCACCGGGCGGGCGGCGGG + Exonic
1175757448 20:61538674-61538696 CCTGTCCCCAGGAGGGTGGATGG + Intronic
1175821081 20:61909154-61909176 CCTTCCACCGGGAGTGTCCCCGG - Intronic
1175838886 20:62014348-62014370 CCTGCCACCGAGAGGAGGACAGG + Intronic
1176553790 21:8243851-8243873 CCTGCCACAGGCAGGCAGGCAGG + Intergenic
1176572712 21:8426875-8426897 CCTGCCACAGGCAGGCAGGCAGG + Intergenic
1176580621 21:8471436-8471458 CCTGCCACAGGCAGGCAGGCAGG + Intergenic
1176682381 21:9826101-9826123 CCTGGGACCCGGAGGGTGGGGGG + Intergenic
1176682660 21:9827510-9827532 CCTGGGACCCGGAGGGTGGGGGG + Intergenic
1176683219 21:9830326-9830348 CCTGGGACCCGGAGGGTGGGGGG + Intergenic
1176683498 21:9831736-9831758 CCTGGGACCCGGAGGGTGGGGGG + Intergenic
1176684055 21:9834546-9834568 CCTGGGACCCGGAGGGTGGGGGG + Intergenic
1178181581 21:30168042-30168064 CCTCCCACCTGGAGTGTGGTTGG - Intergenic
1179518123 21:41923817-41923839 TCTGCCCCCGGGAGGGGAGCGGG - Intronic
1179591993 21:42415019-42415041 CCTGACACCGAGGGGGTGGAGGG + Intronic
1179993246 21:44959498-44959520 CCGCCCACCGGGCAGGTGGCTGG + Intronic
1180983139 22:19888753-19888775 CCAGGCCCCGTGAGGGTGGCTGG - Intronic
1181117388 22:20641182-20641204 CCTGTCACCTGGAGGGTGTTAGG + Intergenic
1181124526 22:20694445-20694467 CCTGACACAGCGAGGGTGGGGGG - Intergenic
1181210561 22:21287236-21287258 CCTGACACTGCGAGGGTGGGGGG - Intergenic
1181443739 22:22952557-22952579 TCTGCCAGCAGGAGGCTGGCTGG - Intergenic
1181501680 22:23319001-23319023 CCTGACACTGCGAGGGTGGGGGG + Intergenic
1181562819 22:23715508-23715530 CCTGTCACAGGGAGGAAGGCTGG + Intergenic
1181592366 22:23893354-23893376 CCTCCCAGCTGGAGGCTGGCTGG + Intronic
1181750999 22:24989234-24989256 TCTCCCACCTGGAGGATGGCAGG + Intronic
1182452989 22:30432356-30432378 CCTGCCACCTGGAGGTCTGCAGG + Intergenic
1182504320 22:30771153-30771175 CCTGCCATCGGCAGGAGGGCAGG + Intronic
1182573827 22:31259450-31259472 CCTCCCACTGGGAGGATTGCAGG - Intronic
1183228530 22:36566310-36566332 CCTGCCACTGGGAAGAAGGCTGG - Intronic
1183498881 22:38166257-38166279 CCAGCCAAAGGGAGGGTGGAAGG - Intronic
1183986230 22:41572042-41572064 CCTTCCACAGGGAGGGCAGCAGG + Exonic
1184074829 22:42169691-42169713 CCTGGCCCTGGGAGGGTGGAGGG - Intronic
1184858200 22:47157992-47158014 CCTGCCGGCTGGAGGGTGACGGG - Intronic
1185001808 22:48250818-48250840 CCTTCCTCCAGGAGAGTGGCAGG - Intergenic
1185315698 22:50178317-50178339 CCTGGCTCCGGGAGGCGGGCAGG - Exonic
1203258794 22_KI270733v1_random:160883-160905 CCTGCCACAGGCAGGCAGGCAGG + Intergenic
950096087 3:10331508-10331530 CATGCCACGGGGAGGGCGGAGGG - Intronic
950575551 3:13830141-13830163 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
952826803 3:37531173-37531195 CCTGCCCCCAGGAGTGTGGCTGG + Intronic
952927757 3:38334171-38334193 CCTGCAACTGGGAGGGTAGATGG + Intergenic
953748690 3:45594013-45594035 CCTGCACCCGGCAGCGTGGCTGG - Intronic
954107181 3:48415682-48415704 ACAGCCACAGGGAGCGTGGCAGG + Exonic
954645931 3:52131557-52131579 CCTGACTCCTGGAGGATGGCTGG - Intronic
955653790 3:61222342-61222364 CCTACCACCAGGGAGGTGGCCGG + Intronic
956150994 3:66242047-66242069 GATGCCACCTGGAGGGTGGAGGG + Intronic
960528385 3:118736281-118736303 CTTGCCACCAGGTGGCTGGCTGG + Intergenic
961378954 3:126484782-126484804 CCTCCCACCTGGAGGCTGGTGGG - Intronic
961604357 3:128082737-128082759 CATGCCTCCTGGAGGGTGCCGGG - Intronic
962848528 3:139290607-139290629 CCTGGCAGCGGCAGGGTGGAGGG - Intronic
964679092 3:159317925-159317947 CCTGCCACCAGGTAGCTGGCTGG + Intronic
965695022 3:171399344-171399366 CCTGCCTCTGGGAGGGAGGGAGG - Intronic
967234301 3:187369191-187369213 CCTGCAACCTGGAGGCTTGCTGG - Intronic
968704738 4:2072643-2072665 CCTGCCCCCGGGAGGATTGGTGG + Intronic
968908760 4:3466235-3466257 CCTGCCCCCGGGCTGATGGCTGG + Intronic
969232435 4:5841157-5841179 CCTGACACAAGGATGGTGGCTGG - Intronic
971825361 4:31614410-31614432 CCTGCCATTGGGAGGGTTCCGGG + Intergenic
972739709 4:41878384-41878406 CCCCCGACCGGGCGGGTGGCCGG + Intergenic
974064618 4:57066055-57066077 CATGCCACCAGAAGGGTGGATGG - Intronic
975087172 4:70355908-70355930 CCTGTCAGGGGGTGGGTGGCTGG + Intergenic
977373455 4:96170287-96170309 CCTCCCACCCGGTAGGTGGCGGG - Intergenic
977753019 4:100632337-100632359 CCTGCCACTGGGTAGCTGGCTGG + Intronic
979290912 4:118977643-118977665 CCTGCCATCAGGAGAATGGCTGG - Intronic
980260038 4:130436971-130436993 CCTGGCAGGGGGAGGGGGGCTGG - Intergenic
981641463 4:146948261-146948283 TTTGCCACCTGGAGGATGGCTGG + Intergenic
982781936 4:159500295-159500317 ACTGCGAACAGGAGGGTGGCAGG + Intergenic
983753895 4:171310135-171310157 CCTGTCAGGGGGTGGGTGGCTGG - Intergenic
984432164 4:179663645-179663667 CCAGGCGACGGGAGGGTGGCTGG - Intergenic
985565974 5:617565-617587 CCTGCCACCGGGACAGGGTCAGG - Intronic
986096200 5:4556081-4556103 TGTGCCACGGGGAGCGTGGCCGG - Intergenic
989273612 5:39560779-39560801 TCTGCCTCCAGAAGGGTGGCAGG - Intergenic
991658134 5:68923641-68923663 GCTGCCACCAGGAGGTTGGTAGG + Intergenic
992840042 5:80679826-80679848 ACTGCCACCTGGAGTGTGGTGGG + Intronic
994093430 5:95827950-95827972 ACTCCCACCTGGAGGGTGACTGG + Intergenic
995348509 5:111148515-111148537 CCTGCCATCAGGTGGCTGGCTGG + Intergenic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
996830258 5:127732834-127732856 CCTGCAAGGGTGAGGGTGGCAGG + Intergenic
997075840 5:130675593-130675615 CCTGTCAGCGGGTGGGAGGCAGG + Intergenic
1000214843 5:159145530-159145552 CCTGTCAGGGGGTGGGTGGCTGG + Intergenic
1000921387 5:167142423-167142445 CTTGCCACCTGGAAAGTGGCAGG - Intergenic
1003080557 6:3017615-3017637 CCTGCCAAAGGGAAGGTGGTGGG + Intronic
1003516734 6:6824512-6824534 CCTGCCATCTCCAGGGTGGCTGG - Intergenic
1006575539 6:35042718-35042740 GATGACACAGGGAGGGTGGCTGG - Intronic
1007251738 6:40500015-40500037 CCTGCCACGGAGAGGATGGGAGG - Intronic
1009964846 6:70567141-70567163 CAGGCCACCGGGTGGGCGGCTGG - Intronic
1014237041 6:118969795-118969817 CCTGTCACGGGGTGGGGGGCAGG - Intronic
1015137128 6:129885598-129885620 CCTGTCATCGGGTGGGGGGCTGG + Intergenic
1016884884 6:148950038-148950060 CCTGCCAATGGAAGGGAGGCAGG - Intronic
1017339324 6:153302231-153302253 GCTGGCACCGGCAGGCTGGCAGG - Intergenic
1017581910 6:155874380-155874402 CCTGCTACCCGGAAGGAGGCTGG + Intergenic
1018291240 6:162294004-162294026 AGGGCCACCTGGAGGGTGGCAGG + Intronic
1019373672 7:677047-677069 CCGGCCTCCGGGAGGTGGGCAGG - Intronic
1024511402 7:50207491-50207513 CATGCTCCTGGGAGGGTGGCAGG + Intergenic
1025020643 7:55476786-55476808 CCTGCCACAGCTTGGGTGGCAGG - Intronic
1025227662 7:57178639-57178661 CCTGTCACAGGGAGGAAGGCTGG + Intergenic
1025929100 7:65980721-65980743 CCTGTCACAGGGAGGAAGGCTGG + Intronic
1026759441 7:73115415-73115437 GCTGACACCTGGAGGGTGCCAGG + Intergenic
1026795499 7:73363840-73363862 CAGGCCACCGGGAGGCTGGCTGG - Intergenic
1026944517 7:74307146-74307168 CCTCCCACAGCAAGGGTGGCCGG + Intronic
1027087969 7:75278058-75278080 GCTGACACCTGGAGGGTGCCAGG - Intergenic
1028459126 7:91071635-91071657 CCTCCCACCAGGAGCTTGGCAGG - Intronic
1029116160 7:98238316-98238338 TGTGCCACCGGGGGGGTGGGAGG + Intronic
1029394080 7:100295191-100295213 GCTGACACCTGGAGGGTGCCAGG - Intergenic
1029533018 7:101137887-101137909 CCTGCCACCGCGGAGGAGGCTGG + Exonic
1029604491 7:101590414-101590436 CAGGCCACCGCGGGGGTGGCTGG - Intergenic
1029620434 7:101687010-101687032 CCTGCCCCAGGGAGGTGGGCAGG + Intergenic
1029730483 7:102434822-102434844 GCTGCCACCTGGGGGGTGGAGGG - Intronic
1032182467 7:129692093-129692115 CCTGCCACCGGGAGGGTGGCAGG - Intronic
1033274699 7:139962580-139962602 GCTGCCACACGGAGGGAGGCAGG + Intronic
1034493983 7:151409579-151409601 CCTGCCAGCGGGATGGGGGGCGG - Exonic
1035205477 7:157291573-157291595 CCTGCCAGCAGGGGTGTGGCAGG + Intergenic
1035404262 7:158587840-158587862 CCTGCCGCCGGGGGCGGGGCCGG - Intergenic
1035648886 8:1249112-1249134 GCTGTCCCTGGGAGGGTGGCTGG + Intergenic
1035733251 8:1867621-1867643 CTGGCCACCTGGAGGGGGGCTGG - Intronic
1036072497 8:5456794-5456816 CCTGCTTCTGGCAGGGTGGCAGG - Intergenic
1038992130 8:32879165-32879187 GCTGCCCAGGGGAGGGTGGCAGG - Intergenic
1042321646 8:67481812-67481834 CCTGACCCTGGGAGGGAGGCAGG + Intronic
1042765273 8:72314397-72314419 CCTGCCACCTGGAGGCAGGCTGG + Intergenic
1043352019 8:79372972-79372994 CCTGTCACGGGGTGGGGGGCAGG + Intergenic
1043791594 8:84475058-84475080 CCTGTCACTGGGTGGGGGGCTGG - Intronic
1044948645 8:97414675-97414697 CCTGTCACCTGGAGAGTGTCTGG - Intergenic
1046012435 8:108565666-108565688 CCTGCCACCAGGGTTGTGGCAGG - Intergenic
1047097426 8:121640058-121640080 CCTGCCTCCGGGCGGCCGGCGGG + Intronic
1049178540 8:141208505-141208527 CCTGTCCCCGGGGGGGAGGCAGG - Intronic
1049259168 8:141629581-141629603 ACTGCCACCCAGAGGCTGGCTGG - Intergenic
1049471207 8:142775775-142775797 CCTGCCCCGGGGAAGGTGACGGG - Intronic
1049659504 8:143813456-143813478 CCTGCCAGCGTGAGTGTGACAGG - Exonic
1049769211 8:144372104-144372126 CCTGCCCCCGAGGGTGTGGCGGG - Intergenic
1051079709 9:13279711-13279733 CCTGCGACCGGCGGGGCGGCGGG + Intergenic
1051548244 9:18300454-18300476 CCTGTCAGGGGGAGGGGGGCTGG + Intergenic
1051937203 9:22457624-22457646 CCTGCCACCAGGTGGCTGGCTGG + Intergenic
1052941132 9:34132865-34132887 CCTGCCCCTGGGATGGGGGCTGG + Intergenic
1052995618 9:34550380-34550402 CCTGCCACGGGGAGTGTATCAGG + Intergenic
1053455963 9:38233300-38233322 CCTGCGCCCTGGAGGCTGGCAGG + Intergenic
1054890541 9:70246309-70246331 CCTGCCAGGGGGTGGGGGGCTGG + Intergenic
1057596457 9:96418894-96418916 CCAGCCGCCGGGCGGGTGGTGGG - Intergenic
1057724353 9:97557560-97557582 CCTGCCACTGGCAGGGTAGCAGG - Intronic
1060413020 9:123412313-123412335 CATTCCACCCGGAGGGTGGGTGG - Intronic
1060544053 9:124450285-124450307 CCTGCCTCCAGGTGGGTGGGAGG - Intergenic
1060770254 9:126327054-126327076 CCTGCAGCCGGGAGGGCGGGCGG + Intronic
1061147432 9:128808149-128808171 TCTGGCACTGGGAGGCTGGCAGG + Exonic
1061327660 9:129874049-129874071 CCTGCCAGCTGCAGAGTGGCGGG + Intronic
1061901403 9:133674043-133674065 CCTGCCAAAGAGAGGGAGGCTGG + Intronic
1062088054 9:134658694-134658716 TCTGTCCCCTGGAGGGTGGCGGG + Intronic
1062137413 9:134936982-134937004 CCAGCCTCATGGAGGGTGGCAGG + Intergenic
1062266110 9:135687287-135687309 CCTTCCACTGGGAGGGTGTGGGG - Intergenic
1062489994 9:136800328-136800350 CCGGCCGCCCGGAGGGTGTCGGG - Intronic
1062498601 9:136842978-136843000 CCTGCCACGGGTGGGGTGGAGGG + Intronic
1062625949 9:137441572-137441594 CCCGCCCCCGGGGGGGTGGGAGG + Intronic
1203474984 Un_GL000220v1:142894-142916 CCTGCCACAGGCAGGCAGGCAGG + Intergenic
1186478994 X:9881424-9881446 CATCTCACCGAGAGGGTGGCAGG - Intronic
1186924149 X:14313686-14313708 CCTGCCACCAGGTTGCTGGCTGG + Intergenic
1190767078 X:53484236-53484258 CCTGTCACCAGGTGGTTGGCTGG + Intergenic
1192174852 X:68879264-68879286 CCAGCTCCTGGGAGGGTGGCAGG - Intergenic
1193403231 X:81070499-81070521 CCTGTCATCGGGTGGGGGGCAGG + Intergenic
1195782211 X:108478888-108478910 CCTGCCACCAGGTAGCTGGCTGG + Intronic
1199190525 X:144964661-144964683 TGTGCCACTGGGAGGGAGGCAGG - Intergenic