ID: 1032182704

View in Genome Browser
Species Human (GRCh38)
Location 7:129694452-129694474
Sequence GAGAATTGCCTCAATCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37596
Summary {0: 1, 1: 1, 2: 148, 3: 3866, 4: 33580}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032182704_1032182712 11 Left 1032182704 7:129694452-129694474 CCTTCCAGATTGAGGCAATTCTC 0: 1
1: 1
2: 148
3: 3866
4: 33580
Right 1032182712 7:129694486-129694508 TCCTGAGTAGCTGGGACTACAGG 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380
1032182704_1032182710 3 Left 1032182704 7:129694452-129694474 CCTTCCAGATTGAGGCAATTCTC 0: 1
1: 1
2: 148
3: 3866
4: 33580
Right 1032182710 7:129694478-129694500 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
1032182704_1032182714 30 Left 1032182704 7:129694452-129694474 CCTTCCAGATTGAGGCAATTCTC 0: 1
1: 1
2: 148
3: 3866
4: 33580
Right 1032182714 7:129694505-129694527 CAGGCATGCGCCACCATGCCTGG 0: 2726
1: 24198
2: 68986
3: 144251
4: 220626
1032182704_1032182708 2 Left 1032182704 7:129694452-129694474 CCTTCCAGATTGAGGCAATTCTC 0: 1
1: 1
2: 148
3: 3866
4: 33580
Right 1032182708 7:129694477-129694499 ACCTCAGCCTCCTGAGTAGCTGG 0: 12610
1: 113153
2: 218440
3: 237917
4: 144947

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032182704 Original CRISPR GAGAATTGCCTCAATCTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr