ID: 1032186848

View in Genome Browser
Species Human (GRCh38)
Location 7:129734058-129734080
Sequence GGTCAGAGAGCTCCACAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032186848 Original CRISPR GGTCAGAGAGCTCCACAAGT GGG (reversed) Intronic
902756673 1:18553457-18553479 GGTCAGGGAGCTGCTGAAGTGGG - Intergenic
902832244 1:19023366-19023388 GGTCATCCAGCTCCACAGGTAGG + Intergenic
904296734 1:29524327-29524349 GGTCAGGGAGCTCCCTAAGGAGG - Intergenic
904463196 1:30692605-30692627 GATCAGGGAGCTCCCCAAGGAGG + Intergenic
907599446 1:55751918-55751940 GGTCAGAGCACTCCTGAAGTTGG + Intergenic
909261231 1:73491633-73491655 GCTCTGAGAACTCCTCAAGTGGG - Intergenic
910800882 1:91144706-91144728 GGTGAAAAAGCTCCATAAGTGGG - Intergenic
911891511 1:103377884-103377906 GGGCAGACTGCTCCTCAAGTGGG + Intergenic
913474871 1:119227540-119227562 GGTGAGAGAGACCCACATGTGGG + Intergenic
913483141 1:119308853-119308875 GGTCAGAGAGATAGAAAAGTAGG + Intergenic
914348962 1:146823216-146823238 GGTAAGAGAGCTCCAAAGGGAGG + Intergenic
915607851 1:156964815-156964837 GGTCTGAGAGCCCCAGAAGGTGG + Intronic
918130659 1:181625559-181625581 GGTGAGAAAGCTGCAGAAGTTGG - Intronic
918304410 1:183232907-183232929 AGTCAGTGAGATCTACAAGTAGG - Intronic
1068623900 10:59218409-59218431 GATCATAGAGCTCCAAAAGTGGG + Intronic
1070480224 10:76875068-76875090 GGCCAAAGAGCTCAACAAGTAGG + Intronic
1071302433 10:84266035-84266057 GGTGAGAGAGATGGACAAGTCGG - Intergenic
1072634045 10:97165865-97165887 GGGCAGACAGCTCCTCAGGTGGG - Intronic
1073073751 10:100810547-100810569 GGTCAGAGAGCTTCCCAGCTGGG - Intronic
1074562151 10:114544202-114544224 GGTCAGGAAGCCCCACAACTAGG - Intronic
1076724043 10:132405124-132405146 GGACAGGGAGCTCCGCAAGCCGG + Exonic
1077633359 11:3825697-3825719 TGGCAGAGAGCTCCACCATTTGG + Exonic
1080931690 11:36817947-36817969 GGTCAGAGAGGCCCACAGGCAGG + Intergenic
1082700885 11:56429051-56429073 GGTGAAAAAGCTCAACAAGTGGG + Intergenic
1083116785 11:60467765-60467787 GGTTAAAGGGCTCCACAAATGGG + Intronic
1083923299 11:65791834-65791856 GGACAGAGAGCACCACAAGCAGG + Intronic
1083938624 11:65883262-65883284 GGACAGAGTGGTCCACAAGCTGG - Exonic
1084374237 11:68764928-68764950 GGGAAGAGAGCTCCCCAAGGCGG - Intronic
1086592907 11:88536978-88537000 GCTCAGAAAGCTTCACAATTTGG + Intronic
1089262353 11:117231968-117231990 GGTCAGGGGGCCCCAGAAGTGGG - Intronic
1090263281 11:125338125-125338147 AGGCAGAGAGCTCCCCAAGGGGG - Intronic
1091746210 12:2994795-2994817 GGTGGGAGAGCTCCACTCGTTGG - Exonic
1096576804 12:52557888-52557910 GGCCAGAGGGCTCCCCAAGCAGG - Intergenic
1104717253 12:131024256-131024278 GGTCAGAGAGGCCCACATGGAGG + Intronic
1104768652 12:131346438-131346460 CCTCAGAGAGCTACACAAGGTGG - Intergenic
1104811372 12:131622152-131622174 CCTCAGAGAGCTACACAAGGTGG + Intergenic
1106533014 13:30612303-30612325 GGACAGAGGGCTCCTCAAATAGG + Intronic
1108704681 13:52974483-52974505 CATCAGAAAGCTCAACAAGTTGG - Intergenic
1111319150 13:86602456-86602478 GGTCAGAGGGTTGCACAAATAGG - Intergenic
1112426143 13:99303077-99303099 GGTCACAGAGCTCCTCAATAAGG - Intronic
1114484528 14:23055005-23055027 GGTGAGAGAGCTCCAGAAGACGG + Intronic
1114640194 14:24214553-24214575 GGTCAAAGAGCTCCAGTAGCTGG + Exonic
1115099900 14:29686213-29686235 GGAGAGAGTGCTCCACAATTTGG + Intronic
1117828069 14:59724240-59724262 GGTGAGAAAGCTCCAAAACTAGG + Intronic
1118259732 14:64235730-64235752 GCTCAGAGAGCTCCAGATGGTGG - Intronic
1122034696 14:98938823-98938845 GTGCAGAGAGCTCCACACTTTGG - Intergenic
1128660103 15:69493861-69493883 AGTCATAAAGCTCCATAAGTGGG + Intergenic
1129580323 15:76802206-76802228 GGTCAAAGACATCCAAAAGTTGG + Intronic
1131091169 15:89625829-89625851 GGTCAGAGTGCTTGACAAGGAGG + Intronic
1132299108 15:100765576-100765598 GGCCTGAGAGCTCCAGAAGGTGG - Intergenic
1136692004 16:32039315-32039337 GGTCACAGAGAACCACAAGGGGG + Intergenic
1137014204 16:35357786-35357808 GGTCCAAGAGCTCATCAAGTTGG - Intergenic
1138205530 16:55121699-55121721 GGTCACACAGCTCAACAAGAGGG + Intergenic
1139618902 16:68120762-68120784 GGTAGGAGAGTTCCAAAAGTGGG - Intronic
1139985071 16:70892339-70892361 GGTAAGAGAGCTCCAAAGGGAGG - Exonic
1141812687 16:86386349-86386371 GGTCACAGAGCTCCAGAATTGGG + Intergenic
1143619492 17:8072955-8072977 GGGCAGAGAGCTCGACAGCTGGG + Intronic
1145839051 17:27978305-27978327 GGTCATAGGGTTCCAAAAGTGGG + Intergenic
1155204083 18:23542545-23542567 GGGCAGACAGCCCCACTAGTGGG + Intronic
1156144291 18:34157700-34157722 GGTCAGAGAGCACAAGAAGATGG + Intronic
1159414103 18:68121550-68121572 GTTCAGAGAGCTCCACATGGCGG - Intergenic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1166312185 19:41969232-41969254 GGGCAGAGAGCTCCAGCAGTGGG + Intronic
1166427400 19:42691807-42691829 GGACAGTGAGCTCCATAATTAGG + Intronic
926012729 2:9421941-9421963 GCTCAGAGAGCTCTTCAGGTGGG - Intronic
926317974 2:11725363-11725385 GGACAGGGAACTCCCCAAGTTGG + Intronic
926811202 2:16756744-16756766 GGTCAGAGAATTCCAGAAGGCGG + Intergenic
926861751 2:17317395-17317417 GGTCAGAGACCTCCTCAAGCTGG + Intergenic
927927577 2:27024471-27024493 GGTGAGAGAGCTCCACAAATTGG + Intronic
930024041 2:47019548-47019570 GGTCAGAGTGGATCACAAGTTGG + Intronic
932749991 2:74365453-74365475 AGGCAGAGAGCTCCAGCAGTGGG + Intronic
933943161 2:87262067-87262089 GGCCAGAGTGCTCCAAAATTTGG + Intergenic
935440399 2:103088071-103088093 GGTGAAAGAGCTCAATAAGTTGG - Intergenic
935589933 2:104836741-104836763 GGTCTAAGAGCCTCACAAGTGGG + Intergenic
936337051 2:111599496-111599518 GGCCAGAGTGCTCCAAAATTTGG - Intergenic
936640211 2:114303784-114303806 GGACAGACTGCTCCTCAAGTAGG - Intergenic
940662540 2:156565162-156565184 AGTCAGAGAGCTTCAAGAGTTGG + Intronic
940806366 2:158191902-158191924 GGTAACAGAGTTCCCCAAGTAGG - Intronic
941297414 2:163757412-163757434 GATCAGAGATTTCCAGAAGTAGG + Intergenic
946448670 2:219761396-219761418 GGTCAGAGACCTCCAAAGGGTGG + Intergenic
947696270 2:232192629-232192651 GCTCAGAGAGCTCCAGGTGTGGG - Intronic
948556534 2:238815031-238815053 GGCCAGAGAGATCCACCAGGAGG - Intergenic
1173257570 20:41405628-41405650 GGCCAGAGAGCTGCACAAGTAGG - Intronic
1175699521 20:61126848-61126870 GCCCAGAGTGCTCCACAGGTGGG - Intergenic
1180061247 21:45386136-45386158 CGTCAGAGCCCTCCACAAGGAGG - Intergenic
1180061285 21:45386282-45386304 CGTCAGAGCCCTCCACAAGGAGG - Intergenic
1181082666 22:20425105-20425127 GGTCGGAGCGCTCCATAACTCGG + Exonic
1181155327 22:20916821-20916843 GGTCAAGGAAGTCCACAAGTGGG - Intergenic
1181594634 22:23906402-23906424 GGAGAGAGACCTTCACAAGTTGG - Intergenic
1181809050 22:25392414-25392436 GGTCAGGGAGCTCCAGGGGTTGG + Intronic
1182159770 22:28109946-28109968 TGTCAGAGAGATACACAAATTGG - Intronic
1183115641 22:35690605-35690627 GGTCAGAGAGCTCCCAAGGGTGG + Intergenic
1183736103 22:39645793-39645815 GGCCCGAGGGCTCCACGAGTGGG - Intronic
952578489 3:34803296-34803318 GGACAGAAAGCTCCACAGGTTGG - Intergenic
954393244 3:50278587-50278609 GCTCTGATAGCTTCACAAGTGGG - Intergenic
957723640 3:84036101-84036123 GGTGAAAGATCTCCACAAGGAGG + Intergenic
959145817 3:102543131-102543153 GTTCAGAGAACTCAAAAAGTGGG - Intergenic
960782899 3:121339852-121339874 GGTGAAAGAGCTCTACAAGGAGG + Intronic
963054501 3:141174773-141174795 GGAGAGAGAGCTCCTCTAGTGGG - Intergenic
963059994 3:141217695-141217717 GTGCAGAGAGCTCAAAAAGTGGG - Intergenic
966593256 3:181704104-181704126 GGAAAGAGAGCTAAACAAGTGGG + Intergenic
966670060 3:182516738-182516760 GGTCAGAGAGCTACAGAGGAGGG + Intergenic
968401868 4:305094-305116 GGGCGCAGAGCTGCACAAGTAGG + Intronic
970475294 4:16415929-16415951 GGTCAGAGAGCTGCAGAGGAGGG + Intergenic
974052600 4:56954992-56955014 GGATTGAGAGCTACACAAGTAGG + Intergenic
974964028 4:68737859-68737881 GGTCAGAGAGCTCAGAAATTGGG + Intergenic
976745590 4:88400040-88400062 GGACAAAGAGCTCGACAAGATGG + Intronic
978611458 4:110545640-110545662 GTTCAGAGAGGACCAAAAGTAGG - Intronic
984016010 4:174427784-174427806 GGTCAGAGAGCAACTCAAGTAGG + Intergenic
987202800 5:15594292-15594314 GGTCAGAGAGGTCAAGAATTTGG + Intronic
989727226 5:44600774-44600796 GGTGAAAGAGCTCTACAAGGAGG - Intergenic
994331487 5:98511752-98511774 GGTCTGAGAGCATGACAAGTGGG - Intergenic
997690840 5:135826423-135826445 GGTCAGAGTGCTGGACAAGATGG - Intergenic
998134438 5:139667365-139667387 GGTCAGAGAGCTCCCAGTGTAGG - Intronic
1002819704 6:713242-713264 TCTCAGAGACCTCAACAAGTAGG - Intergenic
1003419601 6:5944913-5944935 GGTGAAAAAGCTCCATAAGTGGG - Intergenic
1004311306 6:14547839-14547861 GTTCAAAGTGCTCCACAAGCTGG - Intergenic
1015063599 6:128998030-128998052 AGTCAGAGAGCTGCACAGATGGG + Intronic
1017526875 6:155248599-155248621 GCTCAGAGATCTCCACAAGGTGG - Intronic
1018423337 6:163659143-163659165 GGTCAGAGTGCTCCACAGATGGG - Intergenic
1018426133 6:163683876-163683898 GATCACAGAGCTACATAAGTAGG + Intergenic
1019202512 6:170329901-170329923 AGTCAGACAGCTGCTCAAGTTGG - Intronic
1022506182 7:30909881-30909903 GACCAGAGAGCTCCTCATGTGGG + Intergenic
1023981326 7:45072313-45072335 AGTCAGAGAGTTACACAACTTGG - Intronic
1032186848 7:129734058-129734080 GGTCAGAGAGCTCCACAAGTGGG - Intronic
1034283653 7:149870496-149870518 CCTAAGAGAGCTCCAGAAGTAGG + Intergenic
1035225687 7:157430925-157430947 GGTCAGAGAGCTTCCTGAGTGGG + Intergenic
1037098987 8:15019443-15019465 GGAAAGAGAGCTGCACAATTTGG - Intronic
1039951912 8:42179585-42179607 GGTCACACAGCTCAGCAAGTGGG + Intronic
1041537275 8:58940948-58940970 GGTCATAGAGCAGCACATGTAGG + Intronic
1041954576 8:63543263-63543285 GCTCTGAGAGGTCCCCAAGTTGG - Intergenic
1042914051 8:73857225-73857247 GGTCAGAGTCATCAACAAGTAGG + Intronic
1043612503 8:82082914-82082936 GGGCAGAGAGCTGCACCACTGGG - Intergenic
1043869410 8:85415227-85415249 GGTGAAAGAGCTCTACAAGGAGG + Intronic
1044174660 8:89104517-89104539 GGTGAGAAAGCTCAATAAGTGGG + Intergenic
1044342283 8:91060189-91060211 GGTCAGATATCTCCATAGGTAGG - Intergenic
1045888320 8:107125624-107125646 GGTGAAAGAGCTCTACAACTGGG + Intergenic
1047600011 8:126416481-126416503 GGTGAAAAAGCTCCATAAGTGGG - Intergenic
1049614585 8:143570549-143570571 GGTCACACAGCTGCACAAGCTGG - Exonic
1056762969 9:89427891-89427913 GGTCTGAGAGCTCCAGGAGGGGG + Intronic
1058661858 9:107273979-107274001 TGGCAGAGAGCTCAACCAGTGGG + Intergenic
1059346783 9:113634438-113634460 GGACCGAGGGCTCCACAGGTGGG + Intergenic
1059421254 9:114193898-114193920 GGACGCAGAGCTCTACAAGTAGG + Intronic
1186260976 X:7779131-7779153 GGTCAGAGAGCAACACAAAATGG + Intergenic
1191097373 X:56688083-56688105 GGACAGACTGCTCCTCAAGTGGG - Intergenic
1191790009 X:64960068-64960090 GGTCAGTGATCTCCAAAAGATGG + Intronic
1193986926 X:88253436-88253458 GGACAGAGAGCGCAACAAATGGG - Intergenic
1198597383 X:138251301-138251323 GGCCTCAGAGCTCCACAAGCAGG - Intergenic
1199968478 X:152840768-152840790 GGACAGACTGCTCCTCAAGTGGG - Intronic