ID: 1032188272

View in Genome Browser
Species Human (GRCh38)
Location 7:129746453-129746475
Sequence GGTATGTGCCAGTATAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032188272_1032188274 2 Left 1032188272 7:129746453-129746475 CCACTTCTATACTGGCACATACC 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1032188274 7:129746478-129746500 GCCTGTTTTTCTTCATATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032188272 Original CRISPR GGTATGTGCCAGTATAGAAG TGG (reversed) Intronic
907514802 1:54986752-54986774 GGTATGGGACAGAATAGCAGAGG + Intronic
908342069 1:63191808-63191830 GGTATAAGCAAGTATAGAGGGGG - Intergenic
911317694 1:96375387-96375409 GGATTGTGCCCTTATAGAAGCGG + Intergenic
915988991 1:160494094-160494116 GGTATGTGCCAGGATATGAATGG - Intronic
916196482 1:162228441-162228463 GGTATTTGCCAGTTTGTAAGTGG + Intronic
916330168 1:163606857-163606879 GTTATGTGCCATTACAGAATGGG - Intergenic
916507631 1:165442315-165442337 GGCATGTGCCAGTTAAGAGGAGG - Intronic
918546951 1:185695775-185695797 GGTTAGTGCTAGTACAGAAGGGG + Intergenic
919365983 1:196661570-196661592 GATGTGTGCCTTTATAGAAGAGG - Intronic
919399021 1:197085675-197085697 TATATGTGACAGTATAGAAATGG + Intronic
919418162 1:197337140-197337162 GCTATGTGCCCTTATAAAAGAGG + Intronic
920566134 1:206974961-206974983 GTTATTTGCCTGTATAGATGCGG + Intergenic
921651723 1:217687423-217687445 GGTATGTGACTGTATATAAAAGG - Intronic
922025413 1:221743920-221743942 GGTATGTGCCTGCATGTAAGTGG - Intergenic
923096078 1:230776251-230776273 GGTTAGTGCCATTATAAAAGAGG - Intronic
1064584761 10:16828975-16828997 GGTATGTGCCTGGATAGCCGGGG + Exonic
1070555360 10:77523143-77523165 AGGATGTCCCAGTCTAGAAGTGG - Intronic
1073860404 10:107732203-107732225 GGCATGTGCCAGCAAAGCAGTGG + Intergenic
1077878282 11:6325977-6325999 GGGATGGGCCAGTATATAAATGG - Intergenic
1081755360 11:45540460-45540482 GGTCTGTGCCAGTTTAGATGGGG - Intergenic
1082588221 11:54969805-54969827 GTTTTGTGCCAGTATACAAAGGG + Intergenic
1083190264 11:61046447-61046469 GGTATGTGTATGTATAGAGGTGG - Intergenic
1083261425 11:61525098-61525120 GGGAGGTGGCAGTAGAGAAGGGG - Intronic
1085859079 11:80211263-80211285 GATTTGTGCCATTAGAGAAGAGG - Intergenic
1088649881 11:111948164-111948186 GGTATGTGGCCTTGTAGAAGTGG - Intronic
1088713429 11:112528147-112528169 GGTAAGTGCCCTTATAAAAGAGG + Intergenic
1089800462 11:121023155-121023177 GGTGTGTGCCAGAAAAGACGTGG - Intergenic
1092571013 12:9721023-9721045 GCTATTTTCCATTATAGAAGGGG + Intronic
1095645137 12:44534990-44535012 AGTATGAGGCAGTATAGGAGTGG - Intronic
1097961971 12:65541143-65541165 GGTATGTGGCACTGCAGAAGAGG - Intergenic
1098962571 12:76754025-76754047 AGTATATGTCAGCATAGAAGAGG + Intergenic
1107432586 13:40353059-40353081 GGAAAGTGCCAGGACAGAAGTGG - Intergenic
1115160099 14:30384179-30384201 GGAATGAGGCAGTAGAGAAGTGG + Intergenic
1115854262 14:37612263-37612285 GCTGTGTGACACTATAGAAGAGG + Intronic
1116325620 14:43530896-43530918 AGTATCTGCCAGTAAAGTAGAGG + Intergenic
1117342426 14:54803824-54803846 GGTATCTGCCAGTATAGTTTCGG + Intergenic
1124623456 15:31293754-31293776 GGCACATGCCACTATAGAAGGGG + Intergenic
1126106904 15:45152588-45152610 GGTAAGTGCCAGCAGAGAGGGGG - Intronic
1137626571 16:49912620-49912642 GGTATGTGCCTGTATGGAGCTGG + Intergenic
1142953645 17:3505208-3505230 GGTAAGTGCCAGTCTAGTACTGG - Intronic
1147214437 17:38891029-38891051 GGTATGTGCCCCTGTAGGAGGGG + Intronic
1148913262 17:50954712-50954734 GGGATGGGGCTGTATAGAAGGGG - Intergenic
1149246500 17:54714418-54714440 GATTAGTGCCAGTATAAAAGTGG + Intergenic
1150355162 17:64477125-64477147 GATATCTGACAGTATAGATGTGG + Intergenic
1152996871 18:415749-415771 GGTATGTGTCAGCAGAGAAAAGG + Intronic
1153973229 18:10245401-10245423 GGCATGTACCAGTAAAGCAGGGG - Intergenic
1155700482 18:28737064-28737086 GGTTAGTGCCATTATAGAAAAGG + Intergenic
1157238115 18:45982920-45982942 AGAAAGTGCCAGTATGGAAGTGG - Intergenic
1159255884 18:65945044-65945066 ATTATGTGCCTGTATAGGAGTGG + Intergenic
1162757458 19:12868757-12868779 GGGATGTGGCAGTAGAGAAGAGG + Exonic
1164496655 19:28770762-28770784 GCCATGTGCCAGTTTACAAGAGG + Intergenic
1164907136 19:31976705-31976727 GGTATGTGCCAGTTCTGATGGGG - Intergenic
925098176 2:1224099-1224121 GGTCTGTGCCCTTACAGAAGAGG - Intronic
926599268 2:14824408-14824430 GTTATGTGCTGGTATTGAAGAGG - Intergenic
935693181 2:105748058-105748080 TGTATGTGCCAGTACACATGTGG - Intronic
945995405 2:216432164-216432186 GGCATGTGCCTGTAGAGATGGGG + Intronic
947049338 2:226024497-226024519 GCCATGTGCCAGTATGGTAGAGG - Intergenic
947246260 2:228051876-228051898 GATTTGTGCCAGTACAAAAGAGG - Intronic
1170528855 20:17268837-17268859 GGCATAGGCCAGGATAGAAGTGG + Intronic
1177838467 21:26211369-26211391 GGTATCTCCCAGTATACATGAGG + Intergenic
1182809763 22:33105821-33105843 GTTCTGTGCCAGTATAAAAGGGG + Intergenic
1185411311 22:50684415-50684437 AGTGTGTGTCAGTAGAGAAGAGG + Intergenic
951378672 3:21955782-21955804 AGCATGTGCCAGTATGGAATTGG - Intronic
951933278 3:27993827-27993849 GCTCTGTGCCAGCATGGAAGTGG + Intergenic
954219566 3:49144753-49144775 TGTATGTGCCAGGCTTGAAGTGG - Intergenic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
959178463 3:102948207-102948229 TGTATGTGTTAGTAGAGAAGAGG - Intergenic
960695653 3:120393805-120393827 GGTAAGTGCCCTTATAAAAGAGG + Exonic
964125067 3:153227454-153227476 GGTATCAGACTGTATAGAAGTGG + Intergenic
967682211 3:192377376-192377398 TCTATGTGCCAGAAAAGAAGAGG - Intronic
974488656 4:62535516-62535538 GTTATGTTCCAGATTAGAAGAGG + Intergenic
978646200 4:110934726-110934748 GGTATGTGGCAGTATAGACATGG + Intergenic
986093648 5:4535395-4535417 GATTAGTGCCAGTATAAAAGTGG + Intergenic
986576491 5:9218785-9218807 TGAATGTGCCAGTAAAGATGAGG + Intronic
986620135 5:9664169-9664191 GGGGAGTGCCAATATAGAAGAGG - Intronic
988162309 5:27534977-27534999 GGTATGGACCACTATAGAAATGG + Intergenic
993374953 5:87139973-87139995 GGAATGTGCCAGCATAGCACTGG + Intergenic
996961107 5:129251098-129251120 GGTGTGTGTCAGTGTAGAGGAGG - Intergenic
1002936824 6:1681192-1681214 GGCATGTGCCAATGCAGAAGAGG + Intronic
1004727744 6:18327178-18327200 GGTATCTGCCAGTATAAACAAGG - Intergenic
1006247451 6:32751250-32751272 GGTTTGGGGCAGTTTAGAAGTGG + Intergenic
1007520697 6:42450432-42450454 GGCAAGTGCCAGTACTGAAGGGG - Intronic
1008970825 6:57366102-57366124 GGTATGTACCAGCATGGAGGTGG + Intronic
1009159787 6:60267904-60267926 GGTATGTACCAGCATGGATGTGG + Intergenic
1009483086 6:64185010-64185032 GGTCTGTGCCCTTATAAAAGAGG + Intronic
1012248272 6:96951808-96951830 GTTATGTGGAAGTATAGAAGAGG + Intronic
1014677373 6:124383680-124383702 GATAGGTGCTAGTACAGAAGTGG - Intronic
1015878362 6:137846550-137846572 GCTCTGTGCCAGGATAGATGAGG + Intergenic
1016115241 6:140273860-140273882 TGTATGTGTCAATCTAGAAGGGG + Intergenic
1018921625 6:168179771-168179793 GGAATGTGCCTGGATAGAAAGGG + Intergenic
1021796279 7:24257614-24257636 GGTGTGTGCTTTTATAGAAGAGG - Intergenic
1026456669 7:70578689-70578711 GGTAGGTCCCAGTATAGAATAGG - Intronic
1028127728 7:87133412-87133434 GGTATTTGCCAATAAAGAAGTGG - Intergenic
1031960271 7:127983182-127983204 GGTATGGGAAAGTATAGAAATGG + Intronic
1032188272 7:129746453-129746475 GGTATGTGCCAGTATAGAAGTGG - Intronic
1033759649 7:144424751-144424773 GGGGGGTGCAAGTATAGAAGTGG - Intergenic
1036190839 8:6669494-6669516 GGTATTTGACTGTTTAGAAGAGG + Intergenic
1038132883 8:24752995-24753017 GATATCTGACAGTATAGAAAAGG + Intergenic
1038242609 8:25823790-25823812 GGTATGTCCCAGGATAGATAAGG - Intergenic
1044773608 8:95663937-95663959 GGGATGTGCTAGATTAGAAGAGG + Intergenic
1050494721 9:6229065-6229087 TGCAGCTGCCAGTATAGAAGGGG + Intronic
1051032685 9:12701267-12701289 AGTATGTGCCAGGATAGTAGTGG - Intronic
1061691758 9:132338681-132338703 GGCATGTCCCAGAACAGAAGAGG - Intronic
1190826826 X:54025469-54025491 GGTATGTGGCAGTGATGAAGAGG - Intronic
1192435901 X:71143584-71143606 GGCATGTGCCATCATAGAATAGG + Intergenic
1197811196 X:130444912-130444934 GGTAAGTGCCAGGAAAGCAGAGG + Intergenic
1198307464 X:135397327-135397349 GGTGTGTGGCAGTGAAGAAGAGG + Intergenic