ID: 1032189385

View in Genome Browser
Species Human (GRCh38)
Location 7:129755069-129755091
Sequence CTGCACTGGTCCGTTGCCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032189385_1032189398 29 Left 1032189385 7:129755069-129755091 CCCAGGGCAACGGACCAGTGCAG 0: 1
1: 0
2: 2
3: 10
4: 144
Right 1032189398 7:129755121-129755143 ATCAGACAGCGCAGTCACCATGG 0: 1
1: 0
2: 0
3: 6
4: 99
1032189385_1032189392 4 Left 1032189385 7:129755069-129755091 CCCAGGGCAACGGACCAGTGCAG 0: 1
1: 0
2: 2
3: 10
4: 144
Right 1032189392 7:129755096-129755118 CCATGGCCCCTGTGACCACCAGG 0: 1
1: 0
2: 1
3: 28
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032189385 Original CRISPR CTGCACTGGTCCGTTGCCCT GGG (reversed) Exonic
900203189 1:1420350-1420372 CTGCACTGGGCCGCTGCCCTGGG - Exonic
900550019 1:3250032-3250054 CAGCGCTGGGCCGTGGCCCTGGG + Intronic
902545375 1:17186445-17186467 CTGCCCTGGCCCTCTGCCCTGGG - Intergenic
903267745 1:22168281-22168303 CCACACAGGTCCGCTGCCCTGGG - Intergenic
903602059 1:24549743-24549765 CTGCTCTGGTCATTTGCCTTAGG - Intergenic
911973586 1:104465223-104465245 CTGCACTGGTCTGTAGTCCTTGG + Intergenic
913978678 1:143488368-143488390 CTGCCCTGGCCCTGTGCCCTTGG + Intergenic
914073087 1:144314016-144314038 CTGCCCTGGCCCTGTGCCCTTGG + Intergenic
914106067 1:144652344-144652366 CTGCCCTGGCCCTGTGCCCTTGG - Intergenic
914992825 1:152513656-152513678 TTGCACTGGGCAGTGGCCCTAGG + Intronic
915320071 1:155051586-155051608 CCGCCCTGGTCCGCTGTCCTGGG + Intronic
915540131 1:156560692-156560714 CTGCACTGGGCTGTTCTCCTGGG - Intronic
917504997 1:175619368-175619390 CTGCTCTGGGCCATTGTCCTGGG - Intronic
917780761 1:178393598-178393620 CAGTACTGGTCCATGGCCCTGGG + Intronic
918757754 1:188358619-188358641 CTGCACTGAGCCCCTGCCCTAGG - Intergenic
919254708 1:195105912-195105934 CTGCATTGTTCCCTTTCCCTAGG - Intergenic
919810894 1:201408269-201408291 CTGCACTGGTCCTATCCCCCAGG - Exonic
1064267295 10:13835421-13835443 CTGTACTGGTCCGTGGCCCTGGG - Intronic
1065073174 10:22048925-22048947 CTGGACTGGCCCATGGCCCTGGG - Intergenic
1065881288 10:30039646-30039668 CTGGACTGTTCCGTTGACCCTGG - Intronic
1066283365 10:33940097-33940119 CTGCACAGGTCTCATGCCCTGGG + Intergenic
1071491622 10:86140274-86140296 CTGCACTGTCCCCATGCCCTGGG + Intronic
1071611809 10:87038703-87038725 GTGCACTGGTGTGTGGCCCTGGG + Intergenic
1075855475 10:125626036-125626058 CTGCACTGGTCTGTAACCTTGGG - Intronic
1076738449 10:132468884-132468906 CAGCACTGGCCCCTTGCCCTGGG + Intergenic
1077472758 11:2771962-2771984 CTCCACTGCTCCCTGGCCCTGGG + Intronic
1078542723 11:12224544-12224566 CTGCCCTGGCCCCTTGCCTTGGG + Intronic
1083722729 11:64611459-64611481 CTGGTCTGGTCCTGTGCCCTGGG - Intronic
1084653306 11:70501413-70501435 CTGGACTGGACCGTGGGCCTTGG + Intronic
1087177891 11:95111765-95111787 CAGTACTGGTCCATGGCCCTGGG + Intronic
1087428450 11:98019607-98019629 CAGCACTGGTCCATGGCCCAGGG + Intergenic
1088521980 11:110711343-110711365 CTGCACTGGTCCCTGGCCCCTGG - Intronic
1097213625 12:57392517-57392539 CAGCACTGGTCCATGGCCCAGGG + Intronic
1098748418 12:74267583-74267605 CTGTACTGGTCGGTAGTCCTTGG - Intergenic
1099495624 12:83342834-83342856 CTGCACTGTGCCCCTGCCCTAGG + Intergenic
1099974573 12:89533127-89533149 CTGTACTGGTACGTGGCCCAGGG + Intergenic
1101029465 12:100645345-100645367 CTGTACTGGTCAGTAGTCCTTGG + Intergenic
1103544640 12:121691170-121691192 CTGCTCTGCTCCGTTTCCCAAGG - Intergenic
1105220652 13:18323028-18323050 CTGCCCTGGCCCTGTGCCCTTGG - Intergenic
1113125651 13:106975960-106975982 ATGCTCAGGTCCGTTGCCTTCGG + Intergenic
1113574436 13:111383986-111384008 CTGAGCTGCTCCGTGGCCCTGGG + Intergenic
1116285242 14:42962665-42962687 CAGCTCTGGTCCCTTGTCCTTGG - Intergenic
1116862103 14:50003231-50003253 CCGCACTTGCCCGTTGCCATGGG - Intronic
1117224668 14:53642756-53642778 CAGTACTGGTCCATAGCCCTGGG + Intergenic
1119749904 14:77069810-77069832 CTGCACTGTTCCACTGCCCTGGG - Intergenic
1121244645 14:92453087-92453109 CTGCACTGGGCCGGTATCCTTGG - Intronic
1122144052 14:99678264-99678286 CAGTACTGGTCCGTGGCCCAGGG + Exonic
1126175730 15:45733555-45733577 CTGCACTGGTCCTTTTTCCTAGG + Intergenic
1126681823 15:51209742-51209764 CTTTACTGATCTGTTGCCCTTGG + Exonic
1127300432 15:57647731-57647753 CTGCACTTGGCCCTGGCCCTGGG + Intronic
1129866722 15:78914574-78914596 CTTCACTGGTCATATGCCCTTGG + Intergenic
1140239200 16:73185809-73185831 CAGTACTGGTCCGTGGCCCGGGG - Intergenic
1148476020 17:47929165-47929187 CTGCATTGGGCCCTGGCCCTTGG - Intergenic
1151275803 17:73033254-73033276 CAGCACTGGTCCATGGCCCGGGG + Intronic
1154251723 18:12750491-12750513 CGGCACTGCTCTGTTGACCTTGG - Intergenic
1155528142 18:26738467-26738489 TGGTACTGGTCCGTAGCCCTGGG - Intergenic
1157543540 18:48530950-48530972 CTACACTGCTCCCTTCCCCTGGG + Intergenic
1159985943 18:74841063-74841085 CTGCACTGCTCCGGTGTGCTGGG + Intronic
1162175423 19:8826669-8826691 AAGCACTGGTCCGTGGCCCAGGG + Intronic
1163384118 19:16988754-16988776 CAGTACTGGTCCATGGCCCTGGG - Intronic
1164704667 19:30311459-30311481 CTGCACTGCTCTGGTGCCCTAGG + Intronic
1166054653 19:40281088-40281110 CTGCACTGGCCTGTGGGCCTGGG - Intronic
1168191789 19:54743948-54743970 CTGGAATGTTCCGTTGACCTTGG - Exonic
1168194064 19:54760585-54760607 CTGGAATGTTCCGTTGACCTTGG - Intronic
1168196109 19:54775318-54775340 CTGGAATGTTCCGTTGACCTTGG - Exonic
925414744 2:3661521-3661543 CAGCACTGGTCTGTTTCTCTGGG - Intronic
925739425 2:6992685-6992707 CTACAGAGGTCCGTAGCCCTGGG + Intronic
925922082 2:8645042-8645064 CCTCACTGGCCCGGTGCCCTGGG + Intergenic
927717644 2:25362861-25362883 CGGCTCTGCTCCGCTGCCCTCGG - Intergenic
929854686 2:45626835-45626857 CTGCACTGGTCACTAGGCCTGGG + Intergenic
931698607 2:64890708-64890730 CTGCACTGGCCTGTAGTCCTTGG + Intergenic
933727086 2:85433223-85433245 CTGCTCTGGGCCTTTTCCCTTGG - Intronic
933969047 2:87455342-87455364 CTGGACTGGTCCGGTTCCCAGGG - Intergenic
934293686 2:91723619-91723641 CTGCCCTGGCCCTGTGCCCTTGG + Intergenic
934947939 2:98555456-98555478 CTCCACTGATCCCCTGCCCTAGG - Intronic
935239678 2:101167721-101167743 CTGCATTGCGCCCTTGCCCTAGG + Intronic
936229793 2:110690329-110690351 CTGCACAGGGCTGTTTCCCTGGG + Intergenic
936324744 2:111495165-111495187 CTGGACTGGTCCGGTTCCCAGGG + Intergenic
936494692 2:113008191-113008213 CTGGACTGGTCCCTCTCCCTGGG + Intergenic
941488950 2:166119164-166119186 CAGTACTGGTCCGTGGCCCAGGG + Intronic
943156649 2:184187784-184187806 CAGTACTGGTCTGTTGCCCAGGG + Intergenic
946169457 2:217885980-217886002 CTGACCTGGTCCTTAGCCCTGGG + Intronic
947910260 2:233796024-233796046 GTGCACTGCTTCGTAGCCCTTGG + Exonic
948002488 2:234579871-234579893 CTGCCCTGGTCCCTGGCTCTGGG - Intergenic
1171199212 20:23227556-23227578 CTGCAGTGAACCATTGCCCTGGG - Intergenic
1172775432 20:37404079-37404101 CTGAACTGCTCCGTGGCCTTGGG - Exonic
1175820699 20:61907325-61907347 CTGCAGTGGTCCTCTGCCCGGGG + Intronic
1176034953 20:63031673-63031695 CTGGCTTGGCCCGTTGCCCTTGG + Intergenic
1178752348 21:35316963-35316985 CTGCACTGTTCCAGTGCCTTTGG + Intronic
1179286115 21:39978628-39978650 CTGCACTGGTATGACGCCCTTGG - Intergenic
1179667010 21:42919903-42919925 CTGCCCGGGTACCTTGCCCTGGG + Intergenic
1181099284 22:20528590-20528612 CTGTACTGGTCTGTGGCCCAGGG + Intronic
1182778794 22:32851023-32851045 CAGCCCTGGCCAGTTGCCCTTGG + Intronic
1183411642 22:37658545-37658567 CTTCATTGGTCCCTTCCCCTCGG + Intronic
1184461683 22:44641303-44641325 CTCCGCTGGTCTGTTGGCCTAGG - Intergenic
1184472771 22:44704968-44704990 CTGCACAGATCTGTTGTCCTAGG - Intronic
953211186 3:40876544-40876566 CTGCACTGATCCCATGTCCTGGG + Intergenic
953538123 3:43791262-43791284 CTGCTCTTCTCCTTTGCCCTGGG + Intergenic
954766042 3:52917576-52917598 GGGTACTGGTCCGTGGCCCTGGG - Intronic
959620769 3:108396565-108396587 CTGTACTGGTCTGTGGCCCAGGG + Intronic
959911149 3:111765026-111765048 CTGCACTGGCATGTTCCCCTAGG - Intronic
967418278 3:189243765-189243787 CTGCACTGTGCCTCTGCCCTAGG - Intronic
968204827 3:196790026-196790048 CTGTACTGGTCCACGGCCCTGGG + Intronic
968448559 4:664431-664453 CTGCATTGGTCTGTAGCCCTTGG + Intronic
968725920 4:2247756-2247778 CTGTACCGGTCTGTGGCCCTAGG - Exonic
969255489 4:5998955-5998977 TTGCAGTGGTCCGTTCCTCTGGG + Intergenic
969953552 4:10865214-10865236 CAGCTCTGGTACATTGCCCTTGG - Intergenic
971483717 4:27138647-27138669 CGGTACTGGTCCATGGCCCTGGG - Intergenic
973821269 4:54663780-54663802 CTGAACTTGTCCATTGCCCCAGG + Intronic
980626494 4:135380748-135380770 CTGCCCTGTTCCCCTGCCCTGGG + Intergenic
982782672 4:159507356-159507378 CTGTACTGGTCAGCTGCCCAGGG + Intergenic
998314982 5:141174548-141174570 CTGCACCGAGCCGTTGCCCCGGG + Exonic
1002394284 5:178941172-178941194 CTGCGCTTGCGCGTTGCCCTGGG - Exonic
1004165967 6:13256667-13256689 CTGCACTGTGCCTCTGCCCTAGG - Intronic
1008459956 6:51757127-51757149 CTGTACTGGTCTGTGGCCCTGGG + Intronic
1009582074 6:65549154-65549176 CGGCACTGGTCCCTGGCCCAGGG + Intronic
1011423508 6:87200930-87200952 CTGCACTGGGCCGTTTGCCAGGG + Intronic
1013606842 6:111758636-111758658 CTCCACTGGGCATTTGCCCTGGG + Intronic
1018849939 6:167579686-167579708 CTGCGCTGACCCGTTGCCATTGG + Intergenic
1023142724 7:37118322-37118344 CTGCACTGGACCAGTGCTCTGGG - Intronic
1024015220 7:45307503-45307525 CAGTACTGGTCCATGGCCCTGGG + Intergenic
1027395083 7:77746085-77746107 CAGTACCGGTCTGTTGCCCTGGG + Intronic
1030282655 7:107792673-107792695 CTGTACTGGTCTGTGGCCCAGGG + Intronic
1032189385 7:129755069-129755091 CTGCACTGGTCCGTTGCCCTGGG - Exonic
1037411597 8:18604308-18604330 TTGCACTGTGCCTTTGCCCTAGG + Intronic
1037770765 8:21798132-21798154 CTGCAGTCTTCCCTTGCCCTGGG + Intronic
1038507333 8:28095895-28095917 CGGTACTGGTCCGTGGCCCAGGG - Intronic
1039799667 8:40943224-40943246 CTGCACTGGTGACCTGCCCTGGG + Intergenic
1048016911 8:130505847-130505869 CAGCTCTGGTCCCTTGCACTTGG - Intergenic
1049520317 8:143085065-143085087 CTGGGCTGGTGCGTTACCCTGGG - Intergenic
1049520327 8:143085114-143085136 CTGGGCTGGTGCGTTACCCTGGG - Intergenic
1049520337 8:143085163-143085185 CTGGGCTGGTGCGTTACCCTGGG - Intergenic
1049520347 8:143085212-143085234 CTGGGCTGGTGCGTTACCCTGGG - Intergenic
1049520357 8:143085261-143085283 CTGGGCTGGTGCGTTACCCTGGG - Intergenic
1049520367 8:143085310-143085332 CTGGGCTGGTGCGTTACCCTGGG - Intergenic
1049555015 8:143277388-143277410 CTGCACCAGCCCCTTGCCCTGGG + Intergenic
1049735798 8:144203631-144203653 CTGCTCTGGTCAGTGGTCCTTGG + Intronic
1051740442 9:20246712-20246734 CTGCCCTGGTCTGTGGGCCTTGG + Intergenic
1052652811 9:31325572-31325594 CTGCACTGGTCCATGGCCCGGGG + Intergenic
1053109670 9:35447384-35447406 CTACACTGGTACGTTTCCCTTGG + Intergenic
1053198542 9:36137467-36137489 GTGCACAGGTCCCTTCCCCTAGG + Intronic
1053524451 9:38814567-38814589 TTGCACTTGTCTGTTGCCATTGG + Intergenic
1054196686 9:62038976-62038998 TTGCACTTGTCTGTTGCCATTGG + Intergenic
1054641719 9:67549709-67549731 TTGCACTTGTCTGTTGCCATTGG - Intergenic
1056784692 9:89582001-89582023 CTGCAGTGGTGCCCTGCCCTGGG - Intergenic
1059723389 9:116983438-116983460 CTCGACTAGTCAGTTGCCCTAGG + Intronic
1059750345 9:117241714-117241736 CTGTACTGGTCCACAGCCCTGGG + Intronic
1062332206 9:136049774-136049796 CTGGACTGGTCCGCTCCCCCTGG + Exonic
1186274757 X:7927271-7927293 CTGCATTGGTACGGAGCCCTGGG - Exonic
1187230242 X:17414949-17414971 CTGCAGTTCTCTGTTGCCCTTGG + Intronic
1188612678 X:32119035-32119057 CTGTACTGGTCTGTGGCCCCAGG + Intronic
1189337832 X:40181381-40181403 CTGCACGGGTCGCTTGCCCATGG - Intergenic
1192736020 X:73850649-73850671 CTGCACTGCACTGTTGCCATGGG - Intergenic
1193466509 X:81853789-81853811 CTGCACTGCACCCATGCCCTAGG - Intergenic
1197549641 X:127874009-127874031 CTGTACTGGTCCATGGCCCAGGG + Intergenic
1198932423 X:141875766-141875788 CAGCTCTGGTCCCATGCCCTCGG - Intronic
1200911941 Y:8538706-8538728 CTGTACTGGTCTGTAGTCCTTGG - Intergenic