ID: 1032189907

View in Genome Browser
Species Human (GRCh38)
Location 7:129758912-129758934
Sequence GCTCACAGAAACCAGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032189901_1032189907 23 Left 1032189901 7:129758866-129758888 CCTCTGTTACGTAGTTTATCATC No data
Right 1032189907 7:129758912-129758934 GCTCACAGAAACCAGGAGACTGG No data
1032189905_1032189907 -6 Left 1032189905 7:129758895-129758917 CCACACAAGGATCTGGTGCTCAC No data
Right 1032189907 7:129758912-129758934 GCTCACAGAAACCAGGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032189907 Original CRISPR GCTCACAGAAACCAGGAGAC TGG Intergenic