ID: 1032190694

View in Genome Browser
Species Human (GRCh38)
Location 7:129763954-129763976
Sequence GGGTGGGCAAGGAGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032190694_1032190712 18 Left 1032190694 7:129763954-129763976 CCATCCTCCCTCCTTGCCCACCC No data
Right 1032190712 7:129763995-129764017 CCCCCACCCCCTGCTTCTGGAGG No data
1032190694_1032190710 15 Left 1032190694 7:129763954-129763976 CCATCCTCCCTCCTTGCCCACCC No data
Right 1032190710 7:129763992-129764014 AAACCCCCACCCCCTGCTTCTGG No data
1032190694_1032190717 24 Left 1032190694 7:129763954-129763976 CCATCCTCCCTCCTTGCCCACCC No data
Right 1032190717 7:129764001-129764023 CCCCCTGCTTCTGGAGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032190694 Original CRISPR GGGTGGGCAAGGAGGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr