ID: 1032195730

View in Genome Browser
Species Human (GRCh38)
Location 7:129787226-129787248
Sequence CCTCCAGATGGGCTAGCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032195721_1032195730 9 Left 1032195721 7:129787194-129787216 CCTGCAGATGCTGGGTTGGAACC No data
Right 1032195730 7:129787226-129787248 CCTCCAGATGGGCTAGCTTGGGG No data
1032195720_1032195730 10 Left 1032195720 7:129787193-129787215 CCCTGCAGATGCTGGGTTGGAAC No data
Right 1032195730 7:129787226-129787248 CCTCCAGATGGGCTAGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032195730 Original CRISPR CCTCCAGATGGGCTAGCTTG GGG Intergenic