ID: 1032197259

View in Genome Browser
Species Human (GRCh38)
Location 7:129796546-129796568
Sequence GCACGTGCCTGATTGCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032197259_1032197270 18 Left 1032197259 7:129796546-129796568 CCAGAAGGCAATCAGGCACGTGC No data
Right 1032197270 7:129796587-129796609 GTCCCTTCTGTCCTGGGAGAGGG No data
1032197259_1032197265 11 Left 1032197259 7:129796546-129796568 CCAGAAGGCAATCAGGCACGTGC No data
Right 1032197265 7:129796580-129796602 AAGCCCTGTCCCTTCTGTCCTGG No data
1032197259_1032197276 30 Left 1032197259 7:129796546-129796568 CCAGAAGGCAATCAGGCACGTGC No data
Right 1032197276 7:129796599-129796621 CTGGGAGAGGGGCAGGCAGCAGG No data
1032197259_1032197266 12 Left 1032197259 7:129796546-129796568 CCAGAAGGCAATCAGGCACGTGC No data
Right 1032197266 7:129796581-129796603 AGCCCTGTCCCTTCTGTCCTGGG No data
1032197259_1032197269 17 Left 1032197259 7:129796546-129796568 CCAGAAGGCAATCAGGCACGTGC No data
Right 1032197269 7:129796586-129796608 TGTCCCTTCTGTCCTGGGAGAGG No data
1032197259_1032197274 23 Left 1032197259 7:129796546-129796568 CCAGAAGGCAATCAGGCACGTGC No data
Right 1032197274 7:129796592-129796614 TTCTGTCCTGGGAGAGGGGCAGG No data
1032197259_1032197271 19 Left 1032197259 7:129796546-129796568 CCAGAAGGCAATCAGGCACGTGC No data
Right 1032197271 7:129796588-129796610 TCCCTTCTGTCCTGGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032197259 Original CRISPR GCACGTGCCTGATTGCCTTC TGG (reversed) Intergenic
No off target data available for this crispr