ID: 1032197263

View in Genome Browser
Species Human (GRCh38)
Location 7:129796568-129796590
Sequence GGACAGGGCTTACCCCTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032197263_1032197274 1 Left 1032197263 7:129796568-129796590 CCCTAAAGGGGTAAGCCCTGTCC No data
Right 1032197274 7:129796592-129796614 TTCTGTCCTGGGAGAGGGGCAGG No data
1032197263_1032197280 29 Left 1032197263 7:129796568-129796590 CCCTAAAGGGGTAAGCCCTGTCC No data
Right 1032197280 7:129796620-129796642 GGAACAGCCGGTCCATGGCTGGG No data
1032197263_1032197277 17 Left 1032197263 7:129796568-129796590 CCCTAAAGGGGTAAGCCCTGTCC No data
Right 1032197277 7:129796608-129796630 GGGCAGGCAGCAGGAACAGCCGG No data
1032197263_1032197279 28 Left 1032197263 7:129796568-129796590 CCCTAAAGGGGTAAGCCCTGTCC No data
Right 1032197279 7:129796619-129796641 AGGAACAGCCGGTCCATGGCTGG No data
1032197263_1032197269 -5 Left 1032197263 7:129796568-129796590 CCCTAAAGGGGTAAGCCCTGTCC No data
Right 1032197269 7:129796586-129796608 TGTCCCTTCTGTCCTGGGAGAGG No data
1032197263_1032197271 -3 Left 1032197263 7:129796568-129796590 CCCTAAAGGGGTAAGCCCTGTCC No data
Right 1032197271 7:129796588-129796610 TCCCTTCTGTCCTGGGAGAGGGG No data
1032197263_1032197266 -10 Left 1032197263 7:129796568-129796590 CCCTAAAGGGGTAAGCCCTGTCC No data
Right 1032197266 7:129796581-129796603 AGCCCTGTCCCTTCTGTCCTGGG No data
1032197263_1032197276 8 Left 1032197263 7:129796568-129796590 CCCTAAAGGGGTAAGCCCTGTCC No data
Right 1032197276 7:129796599-129796621 CTGGGAGAGGGGCAGGCAGCAGG No data
1032197263_1032197278 24 Left 1032197263 7:129796568-129796590 CCCTAAAGGGGTAAGCCCTGTCC No data
Right 1032197278 7:129796615-129796637 CAGCAGGAACAGCCGGTCCATGG No data
1032197263_1032197270 -4 Left 1032197263 7:129796568-129796590 CCCTAAAGGGGTAAGCCCTGTCC No data
Right 1032197270 7:129796587-129796609 GTCCCTTCTGTCCTGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032197263 Original CRISPR GGACAGGGCTTACCCCTTTA GGG (reversed) Intergenic
No off target data available for this crispr