ID: 1032197267

View in Genome Browser
Species Human (GRCh38)
Location 7:129796583-129796605
Sequence CTCCCAGGACAGAAGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032197267_1032197276 -7 Left 1032197267 7:129796583-129796605 CCCTGTCCCTTCTGTCCTGGGAG No data
Right 1032197276 7:129796599-129796621 CTGGGAGAGGGGCAGGCAGCAGG No data
1032197267_1032197280 14 Left 1032197267 7:129796583-129796605 CCCTGTCCCTTCTGTCCTGGGAG No data
Right 1032197280 7:129796620-129796642 GGAACAGCCGGTCCATGGCTGGG No data
1032197267_1032197282 22 Left 1032197267 7:129796583-129796605 CCCTGTCCCTTCTGTCCTGGGAG No data
Right 1032197282 7:129796628-129796650 CGGTCCATGGCTGGGCTCCCAGG No data
1032197267_1032197278 9 Left 1032197267 7:129796583-129796605 CCCTGTCCCTTCTGTCCTGGGAG No data
Right 1032197278 7:129796615-129796637 CAGCAGGAACAGCCGGTCCATGG No data
1032197267_1032197279 13 Left 1032197267 7:129796583-129796605 CCCTGTCCCTTCTGTCCTGGGAG No data
Right 1032197279 7:129796619-129796641 AGGAACAGCCGGTCCATGGCTGG No data
1032197267_1032197277 2 Left 1032197267 7:129796583-129796605 CCCTGTCCCTTCTGTCCTGGGAG No data
Right 1032197277 7:129796608-129796630 GGGCAGGCAGCAGGAACAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032197267 Original CRISPR CTCCCAGGACAGAAGGGACA GGG (reversed) Intergenic
No off target data available for this crispr