ID: 1032197276

View in Genome Browser
Species Human (GRCh38)
Location 7:129796599-129796621
Sequence CTGGGAGAGGGGCAGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032197268_1032197276 -8 Left 1032197268 7:129796584-129796606 CCTGTCCCTTCTGTCCTGGGAGA No data
Right 1032197276 7:129796599-129796621 CTGGGAGAGGGGCAGGCAGCAGG No data
1032197267_1032197276 -7 Left 1032197267 7:129796583-129796605 CCCTGTCCCTTCTGTCCTGGGAG No data
Right 1032197276 7:129796599-129796621 CTGGGAGAGGGGCAGGCAGCAGG No data
1032197259_1032197276 30 Left 1032197259 7:129796546-129796568 CCAGAAGGCAATCAGGCACGTGC No data
Right 1032197276 7:129796599-129796621 CTGGGAGAGGGGCAGGCAGCAGG No data
1032197264_1032197276 7 Left 1032197264 7:129796569-129796591 CCTAAAGGGGTAAGCCCTGTCCC No data
Right 1032197276 7:129796599-129796621 CTGGGAGAGGGGCAGGCAGCAGG No data
1032197263_1032197276 8 Left 1032197263 7:129796568-129796590 CCCTAAAGGGGTAAGCCCTGTCC No data
Right 1032197276 7:129796599-129796621 CTGGGAGAGGGGCAGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032197276 Original CRISPR CTGGGAGAGGGGCAGGCAGC AGG Intergenic
No off target data available for this crispr