ID: 1032197277

View in Genome Browser
Species Human (GRCh38)
Location 7:129796608-129796630
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032197264_1032197277 16 Left 1032197264 7:129796569-129796591 CCTAAAGGGGTAAGCCCTGTCCC No data
Right 1032197277 7:129796608-129796630 GGGCAGGCAGCAGGAACAGCCGG No data
1032197272_1032197277 -4 Left 1032197272 7:129796589-129796611 CCCTTCTGTCCTGGGAGAGGGGC No data
Right 1032197277 7:129796608-129796630 GGGCAGGCAGCAGGAACAGCCGG No data
1032197263_1032197277 17 Left 1032197263 7:129796568-129796590 CCCTAAAGGGGTAAGCCCTGTCC No data
Right 1032197277 7:129796608-129796630 GGGCAGGCAGCAGGAACAGCCGG No data
1032197273_1032197277 -5 Left 1032197273 7:129796590-129796612 CCTTCTGTCCTGGGAGAGGGGCA No data
Right 1032197277 7:129796608-129796630 GGGCAGGCAGCAGGAACAGCCGG No data
1032197267_1032197277 2 Left 1032197267 7:129796583-129796605 CCCTGTCCCTTCTGTCCTGGGAG No data
Right 1032197277 7:129796608-129796630 GGGCAGGCAGCAGGAACAGCCGG No data
1032197268_1032197277 1 Left 1032197268 7:129796584-129796606 CCTGTCCCTTCTGTCCTGGGAGA No data
Right 1032197277 7:129796608-129796630 GGGCAGGCAGCAGGAACAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032197277 Original CRISPR GGGCAGGCAGCAGGAACAGC CGG Intergenic
No off target data available for this crispr