ID: 1032197282

View in Genome Browser
Species Human (GRCh38)
Location 7:129796628-129796650
Sequence CGGTCCATGGCTGGGCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032197275_1032197282 7 Left 1032197275 7:129796598-129796620 CCTGGGAGAGGGGCAGGCAGCAG No data
Right 1032197282 7:129796628-129796650 CGGTCCATGGCTGGGCTCCCAGG No data
1032197268_1032197282 21 Left 1032197268 7:129796584-129796606 CCTGTCCCTTCTGTCCTGGGAGA No data
Right 1032197282 7:129796628-129796650 CGGTCCATGGCTGGGCTCCCAGG No data
1032197267_1032197282 22 Left 1032197267 7:129796583-129796605 CCCTGTCCCTTCTGTCCTGGGAG No data
Right 1032197282 7:129796628-129796650 CGGTCCATGGCTGGGCTCCCAGG No data
1032197272_1032197282 16 Left 1032197272 7:129796589-129796611 CCCTTCTGTCCTGGGAGAGGGGC No data
Right 1032197282 7:129796628-129796650 CGGTCCATGGCTGGGCTCCCAGG No data
1032197273_1032197282 15 Left 1032197273 7:129796590-129796612 CCTTCTGTCCTGGGAGAGGGGCA No data
Right 1032197282 7:129796628-129796650 CGGTCCATGGCTGGGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032197282 Original CRISPR CGGTCCATGGCTGGGCTCCC AGG Intergenic
No off target data available for this crispr