ID: 1032206464

View in Genome Browser
Species Human (GRCh38)
Location 7:129870155-129870177
Sequence GAGGCCTGGTGTTTGAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 689
Summary {0: 1, 1: 0, 2: 1, 3: 55, 4: 632}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032206464_1032206470 14 Left 1032206464 7:129870155-129870177 CCTCTTCTCAAACACCAGGCCTC 0: 1
1: 0
2: 1
3: 55
4: 632
Right 1032206470 7:129870192-129870214 GCTCCCTCCTTCCTTCTCGATGG 0: 1
1: 0
2: 1
3: 27
4: 266
1032206464_1032206472 17 Left 1032206464 7:129870155-129870177 CCTCTTCTCAAACACCAGGCCTC 0: 1
1: 0
2: 1
3: 55
4: 632
Right 1032206472 7:129870195-129870217 CCCTCCTTCCTTCTCGATGGTGG 0: 1
1: 0
2: 1
3: 17
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032206464 Original CRISPR GAGGCCTGGTGTTTGAGAAG AGG (reversed) Intronic
900194443 1:1368533-1368555 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
900722107 1:4183523-4183545 GAGGGCTGGTGTCTGGGATGAGG + Intergenic
900841214 1:5050089-5050111 GAGGGCTGGTGTCTGGGATGAGG - Intergenic
900957123 1:5892879-5892901 GGGGCGTGGTGTTTGTGAAGGGG - Intronic
901075526 1:6552576-6552598 GAGGTCAGGAGTTTGAGATGTGG - Intronic
901304383 1:8222065-8222087 GAGGCCAGGAGTTTGAGATCAGG - Intergenic
901312824 1:8282606-8282628 GTGGCTTGGTGTCTGAGAAGGGG + Intergenic
901477248 1:9498500-9498522 GAGGCGAGGAGTTTGAGAACAGG - Intergenic
901736728 1:11317319-11317341 GAGGCCAGGAGTTTGAGACTTGG - Intergenic
902575882 1:17377199-17377221 GAGGCCAGGAGTTTGAGACCAGG - Intronic
902807615 1:18870964-18870986 GAAGCCTGGAGTTTGAGACCTGG - Intronic
903105483 1:21075353-21075375 GAGGCCAGGAGTTTGAGATGAGG + Intronic
903135711 1:21308100-21308122 GAGGTCTGGAGGTAGAGAAGTGG - Intronic
903876397 1:26477032-26477054 GTGGGCTGGTATTTGAGCAGAGG + Intergenic
903981586 1:27192577-27192599 GAGGCCAGGAGTTTGAGACCTGG - Intergenic
904688118 1:32275038-32275060 GAGATCTGGGCTTTGAGAAGGGG + Exonic
905429611 1:37912034-37912056 GAGGGCTGGTGTCTGGGACGAGG - Intronic
905594085 1:39190779-39190801 GAGGCCAGGAGTTTGAGACTGGG + Intronic
906011960 1:42535644-42535666 GAGCCCAGGAGTTTGAGAACAGG + Intronic
906382426 1:45341235-45341257 GAGGGCAGGTGGTTGTGAAGGGG + Intronic
906477900 1:46182120-46182142 GGGGCCTGGTTTGTGGGAAGGGG + Intronic
906689452 1:47782989-47783011 GAGGCCTCGTGGATGAGAAGAGG + Intronic
907071694 1:51541402-51541424 GAGGCCATGAGTTTGAGTAGGGG - Intergenic
907455155 1:54570894-54570916 GAGGCCAGGAGTTTGAGACCAGG - Intronic
907688315 1:56636095-56636117 GAGGCCTGGAGTTTGAGACCAGG - Intronic
908405451 1:63810054-63810076 AAGGCCAGGTGTTTGTGTAGGGG + Intronic
908737706 1:67293188-67293210 GAGGCCAGGAGTTCGAGATGAGG - Intergenic
908872337 1:68627850-68627872 TAGGCCTTTTGTTTGAGAATTGG + Intergenic
909729922 1:78877907-78877929 GAGGGCTGGTGTCTGGGATGAGG - Intergenic
909870434 1:80731721-80731743 GCTGCCTGGAGTTAGAGAAGGGG - Intergenic
910591821 1:88934239-88934261 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
910694829 1:90000945-90000967 GGGGCCTGGTGTTGTAGTAGTGG + Intronic
910821036 1:91346907-91346929 GAGGCCAGGAGTTTGAGACCAGG + Intronic
911373596 1:97024172-97024194 GCAGCCTGGGGTTTGGGAAGGGG - Intergenic
913963400 1:143355732-143355754 GAGGCCAGGAGTTTGAGAACAGG - Intergenic
914057756 1:144181321-144181343 GAGGCCAGGAGTTTGAGAACAGG - Intergenic
914121390 1:144785044-144785066 GAGGCCAGGAGTTTGAGAACAGG + Intergenic
914253004 1:145937370-145937392 GAGGCCAGGAGTTTGAGACATGG - Intronic
916801251 1:168218599-168218621 GAGGCCAGGAGTTTGAGACTTGG + Intergenic
916847530 1:168668445-168668467 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
918507542 1:185273189-185273211 GAGGTCAGGAGTTTGAGAACAGG + Intronic
918889735 1:190251001-190251023 GAGGCCAGGAGTTTGAGACCAGG + Intronic
919674833 1:200370958-200370980 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
920263918 1:204707883-204707905 GAGTCCTGGTGTTTGAGGTCAGG - Intergenic
921520420 1:216149624-216149646 GAGGGCTGGTGTCTGGGATGAGG - Intronic
922044237 1:221928230-221928252 GCCGCCTGGGGTTGGAGAAGGGG - Intergenic
922873791 1:228924073-228924095 GAGGCCAGGAGTTTGAGACAAGG - Intergenic
923075581 1:230606080-230606102 GAGGGCTGGTGTCTGGGATGAGG - Intergenic
923109439 1:230879544-230879566 GAGGCAGGGTGATTGAGGAGGGG - Intergenic
923113580 1:230913566-230913588 GAGGCCAGGAGTTTGAGACCAGG - Intronic
923557097 1:235009842-235009864 GAAGACTGGTGTTGGGGAAGAGG + Intergenic
924497445 1:244603790-244603812 GAGGCCAGGTGTTCAAGATGAGG + Intronic
924772719 1:247090477-247090499 GGGCCCTGATCTTTGAGAAGGGG + Intergenic
924801159 1:247330680-247330702 GAGGCCTGATGGCAGAGAAGGGG - Intronic
1062821619 10:538366-538388 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1063684222 10:8221053-8221075 GAGGCCAGGAGTTTGAGACTAGG + Intergenic
1064054596 10:12086898-12086920 GAGGCCAGGAGTTTGAGACTTGG - Intronic
1064118854 10:12602277-12602299 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1064625755 10:17259653-17259675 GAGCCCTGGAGTTTGAGACCAGG + Intergenic
1064843863 10:19629120-19629142 GAGGCTTGCTTTTTGGGAAGGGG - Intronic
1064948018 10:20814380-20814402 GAGGCCTGGGATTTGAGACTAGG + Intronic
1064965348 10:21010465-21010487 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1065246234 10:23761034-23761056 GAGGCCAGGAGTTTGAGATTAGG + Intronic
1066484814 10:35833262-35833284 GAAGCCAGGTGTTTGAGAACAGG - Intergenic
1066950828 10:42113870-42113892 GAGGGTTGGTGTTTGCAAAGGGG + Intergenic
1067510699 10:46892746-46892768 GGGGCCTGATGTTGGAGAACTGG + Intergenic
1067651556 10:48159116-48159138 GGGGCCTGATGTTGGAGAACTGG - Intronic
1068361266 10:55977027-55977049 GAGGGCTGGTGTCTGGGACGAGG - Intergenic
1068982991 10:63081097-63081119 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1069737218 10:70664716-70664738 GAGACCTGTGGTTTCAGAAGAGG + Intergenic
1069866353 10:71505746-71505768 GAGGCCTGGTGTTTTTTCAGCGG - Intronic
1070316722 10:75320602-75320624 GAGGCCAGGAGTTTGAGACTAGG + Intergenic
1071089114 10:81898218-81898240 GAAGCCAAGTGTTTGAGCAGTGG + Intronic
1071665134 10:87547324-87547346 GAGGCCAAGAGTTTGAGAACAGG - Intronic
1071800623 10:89055869-89055891 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1072100934 10:92228488-92228510 GACTCCTGGAGTTTGAGTAGGGG + Intronic
1072298700 10:94038178-94038200 GAGTCCTGGGGTTAGAGAGGAGG + Intronic
1073130481 10:101185695-101185717 GAGGGCTGGTGTCTGGGATGAGG + Intergenic
1074454897 10:113588272-113588294 GGGGCCTGGAGTGTGGGAAGAGG + Exonic
1074823600 10:117199102-117199124 GAGGCCAGGAGTTTGAGACTAGG + Intronic
1075021455 10:118955699-118955721 GAACCCTGGAGTCTGAGAAGGGG - Intergenic
1075094198 10:119460535-119460557 GAGGCCTTGGCTTTGAGCAGGGG + Intergenic
1077598178 11:3552796-3552818 GAGGCCAGGAGTTTGAGCACAGG - Intergenic
1078498160 11:11841552-11841574 GAGGCCTGGGGTATCTGAAGAGG + Intronic
1078508331 11:11968027-11968049 GAGGCCGGGAGTTCGAGAAGGGG - Intronic
1078779973 11:14428513-14428535 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1079779412 11:24581455-24581477 GAGGCCAGGAGTTTGAGATCAGG + Intronic
1079924031 11:26470194-26470216 GAGCCCAGGAGTTTGAGAACAGG + Intronic
1080616670 11:33950345-33950367 GAGGCCTGGATTTTCAGCAGGGG + Intergenic
1081095106 11:38922411-38922433 GAGGCCAGGAGTTTGAGACTAGG - Intergenic
1083326795 11:61877018-61877040 GAGGCCTGGTGGGTGGGAGGAGG + Intronic
1083380029 11:62259471-62259493 GAGGCCTGCAGTTTGAGACCAGG + Intergenic
1083858271 11:65404668-65404690 GAGTCCTGGTGGATGAGGAGGGG - Intronic
1084085712 11:66854177-66854199 GTGGCCTGGAGATGGAGAAGAGG - Intronic
1084157383 11:67321504-67321526 CAGGCCTGGTACTTGATAAGAGG + Intronic
1084354658 11:68629816-68629838 GAGGGCTGGTGTCTGGGATGAGG - Intergenic
1084610738 11:70201312-70201334 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1084961598 11:72719778-72719800 GAGGGCTGGAGTGTGAGTAGTGG - Intronic
1086381566 11:86260440-86260462 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1087167622 11:95020867-95020889 GAGGACTGGTGTCTGGGACGAGG + Intergenic
1087197343 11:95314748-95314770 GAGGGCTGGTGTCTGGGATGAGG - Intergenic
1087449675 11:98303321-98303343 AAGACCTTGTGTTTGAGGAGAGG - Intergenic
1088412578 11:109551560-109551582 GTGGCCTGCTTTTTTAGAAGAGG + Intergenic
1089239214 11:117061031-117061053 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1089289093 11:117427039-117427061 GAGGCCTGGTTTCTGATGAGAGG - Intergenic
1089651286 11:119915086-119915108 GAAGCCAGGAGTTTGAGAAAAGG + Intergenic
1089953797 11:122552568-122552590 GAGGGCTGGTGTCTGGGATGAGG - Intergenic
1090500769 11:127258432-127258454 GAGGCAGGGTGGTTGAGAGGAGG - Intergenic
1090520449 11:127473744-127473766 TAGGCCTAGTGTTAGAGAGGAGG + Intergenic
1091026697 11:132147894-132147916 GAGGCCTGCTGTTTGACAGTAGG + Intronic
1091321420 11:134655033-134655055 AAGTCCTGGAGTTTGCGAAGAGG - Intergenic
1091793358 12:3283898-3283920 CAGGCCTGGTGTCTGAGGACAGG + Exonic
1092215885 12:6682076-6682098 GAGGTCTGGAGTTTGAGACCAGG + Intronic
1092947511 12:13470564-13470586 GAGGACTGGTATGTGAGATGAGG - Intergenic
1093248279 12:16767632-16767654 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1093358924 12:18200640-18200662 GAGGGCTGGTGTCTGGGATGAGG - Intronic
1093426623 12:19035186-19035208 GAGTCTTGGAATTTGAGAAGTGG - Intergenic
1093448829 12:19292190-19292212 GAGGCCAGGAGTTCGAGACGAGG + Intronic
1094826216 12:34271173-34271195 GAGGGCTGGTGTCTGGGATGAGG - Intergenic
1095635477 12:44428408-44428430 GAGACATGGTGTTTGAGCAGAGG + Intergenic
1095806298 12:46324202-46324224 GAGGGCTGGTGTCTGGGATGAGG + Intergenic
1096329657 12:50699629-50699651 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1096449355 12:51724230-51724252 GAGGTCTGGAGTTTGAGACCAGG + Intronic
1096775303 12:53960055-53960077 GGGGCCTGGTGTTTGAGCCTGGG + Intergenic
1097002601 12:55890262-55890284 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1097053821 12:56238643-56238665 GTGGCCTGGAGCTGGAGAAGGGG + Exonic
1097654997 12:62347986-62348008 GAGGCCAGGAGTTTGAGACTAGG + Intronic
1097671928 12:62550313-62550335 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1097766254 12:63530552-63530574 GAGGCCGGGAGTTTGAGATCAGG + Intergenic
1097782689 12:63726393-63726415 GAGGCCAGGAGTTTGAGATCAGG + Intergenic
1097883051 12:64703390-64703412 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1098126856 12:67305600-67305622 GAGGCCTGTTCTGGGAGAAGGGG + Exonic
1099558187 12:84138274-84138296 GAGGCCAGGAGTTTGAGTACAGG + Intergenic
1100256659 12:92889683-92889705 GAGGTCAGGTGTTTGAGACCAGG + Intronic
1100267155 12:92988474-92988496 GAGGCCTGGAGTTTAAGACCAGG - Intergenic
1100427553 12:94501401-94501423 GAGATCTGATGTTTGATAAGGGG - Intergenic
1100470086 12:94883561-94883583 GAGGCCAGGAGTTTGAGACAAGG + Intergenic
1100602790 12:96126557-96126579 GAGGCCAGGAGTTTGAGACAAGG - Intergenic
1101125821 12:101632946-101632968 GAGGCCTGGAGTTTGAGACTAGG - Intronic
1102231475 12:111265554-111265576 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1102362463 12:112300099-112300121 GAGGTCAGGAGTTTGAGACGAGG + Intronic
1102377430 12:112434063-112434085 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1102665574 12:114569725-114569747 GAGGCCAGGAGTTTGAGACGAGG - Intergenic
1102839548 12:116103498-116103520 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1102971784 12:117173928-117173950 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1103305195 12:119958633-119958655 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1103397889 12:120622094-120622116 GAGGCCTGGCCTTGGTGAAGAGG + Intergenic
1103538061 12:121647071-121647093 GCGGCCTGGTGTGAGACAAGAGG - Intergenic
1103639151 12:122335033-122335055 AAGGTCTGCTGTTTGAGAGGTGG - Intronic
1103641425 12:122355593-122355615 GAGGCCAGGAGTTTGAGACCTGG + Intronic
1103877934 12:124143266-124143288 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1103980238 12:124732491-124732513 GAGACCTGGTGTTTGGGACGAGG - Intergenic
1105023663 12:132834662-132834684 GAGGCTTGGTGACAGAGAAGAGG - Intronic
1105438877 13:20399735-20399757 GTAGCCTGGTGGTTGAGCAGGGG - Intergenic
1105638129 13:22235927-22235949 CAGGCCTGTGGTTTGAGACGAGG - Intergenic
1108325239 13:49324096-49324118 GAGGTCAGGAGTTTGAGAACAGG + Intronic
1109179470 13:59196890-59196912 GAGCATTGGTGTTTGAGAATGGG + Intergenic
1109583659 13:64371464-64371486 GCTGCCTGGGGTTGGAGAAGTGG + Intergenic
1110302740 13:73948430-73948452 GAGGCCGGGAGTTCGAGAACAGG - Intronic
1110441259 13:75528592-75528614 GAGGTCAGGAGTTTCAGAAGTGG + Intronic
1111345069 13:86940942-86940964 GAGGCCTGGGGGTAGGGAAGCGG + Intergenic
1111855526 13:93632394-93632416 GAGCCCAGGAGTTTGAGATGAGG + Intronic
1112026394 13:95415033-95415055 GAGGCCAGGAGTTTGAGACCGGG - Intergenic
1113217556 13:108060550-108060572 GTTGCCTGGTGTTGGAGGAGGGG - Intergenic
1113644529 13:111983354-111983376 GGGGCTTGGTGTGAGAGAAGTGG + Intergenic
1114294560 14:21317318-21317340 GAGGCATGGGGTTTGAGAAAAGG + Intronic
1115027338 14:28760270-28760292 ATGGCCTCGTGTTGGAGAAGGGG + Intergenic
1116963636 14:50992362-50992384 GAGGCCGGGAGTTTGAGACCGGG + Intronic
1117217608 14:53568073-53568095 TATGGCTGGTGTCTGAGAAGAGG + Intergenic
1117284288 14:54271923-54271945 GATGCTTTGTGTTTGAGAAAGGG - Intergenic
1117608637 14:57459632-57459654 GAGGTCTGGAGTTTGAGACCAGG - Intergenic
1118736371 14:68704414-68704436 GGGGCCTTATGTTTGAGAGGTGG - Intronic
1118936850 14:70296443-70296465 GAGGGCTGGTGTCTGGGATGAGG + Intergenic
1119319788 14:73723361-73723383 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1122041352 14:98989879-98989901 GAGGGCTGGTGTCTGGGATGAGG - Intergenic
1122304657 14:100754867-100754889 GAGGCCAGGAGTTTGAGACAAGG + Intergenic
1122385530 14:101343204-101343226 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1122739319 14:103862095-103862117 GAGGCCAGGAGTTTGAGATCAGG + Intergenic
1122867226 14:104611986-104612008 GAGCCCCCGTGTTTCAGAAGTGG - Intergenic
1122944177 14:104998191-104998213 GAGGCCGGGAGTTTGAGACCAGG + Intronic
1123009897 14:105344010-105344032 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1123700705 15:22912980-22913002 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1125538482 15:40456437-40456459 GGGGCCTGGTCTCTGAGCAGTGG + Intronic
1125725513 15:41866393-41866415 AAGGCCTGGTGTTTCAGCAGGGG + Exonic
1125829968 15:42708217-42708239 AAGGCTTGGTGTTTCAGTAGGGG + Intronic
1126155460 15:45561727-45561749 GAGCCCAGGAGTTTGAGGAGTGG + Intergenic
1126773021 15:52076575-52076597 GAGGCCAGGAGTTTGAGACTAGG - Intergenic
1126892743 15:53223555-53223577 GAGTCCTAGTGTGTGAGTAGAGG + Intergenic
1127050292 15:55076112-55076134 GGGGCCTGCTGTCTAAGAAGAGG + Intergenic
1127410373 15:58699543-58699565 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1127416758 15:58765443-58765465 GAGGCCAGGAGTTTGAGATAAGG + Intergenic
1129670962 15:77607489-77607511 CAGTGCTGGTGTCTGAGAAGGGG - Intergenic
1129874775 15:78966700-78966722 CAGGCCTGGTGGCTGAGAAGGGG - Intronic
1130933482 15:88449381-88449403 GAAGCCTGGTATTTGAGCACAGG + Intergenic
1131130937 15:89899863-89899885 GGGGGCTGGTGTTTGAGATGAGG - Exonic
1131182075 15:90247344-90247366 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1131469707 15:92685306-92685328 GAGGCCTGGTTTTTGATGAGTGG - Intronic
1131924378 15:97365815-97365837 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1131932116 15:97454399-97454421 GAGGACTGATATTTGATAAGAGG + Intergenic
1131994167 15:98118625-98118647 GAGGTCTGGAGTTTGAGACCAGG - Intergenic
1132372503 15:101308389-101308411 GAGGCCTGGTGTCTGAGCGTGGG - Intronic
1133519327 16:6542137-6542159 GAGGCCAGGAGTTTGAGACGAGG - Intronic
1133703772 16:8333863-8333885 GAGACCTGGTGGTTTAAAAGTGG + Intergenic
1133766377 16:8840950-8840972 GAGGGCTGGTGTCTGGGATGAGG + Intronic
1133915810 16:10108515-10108537 GAGGCCTGGGGTTTGAGTTCTGG - Intronic
1133988434 16:10685981-10686003 GAGGGCTGACGTTTGGGAAGTGG - Intronic
1133989854 16:10696342-10696364 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1134059415 16:11190087-11190109 GAGCCCAGGAGTTTGAGATGAGG - Intergenic
1134674783 16:16082367-16082389 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1135244208 16:20840861-20840883 ATGGCCTGGTATTTGAGAAATGG - Intronic
1135546038 16:23367509-23367531 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1135847715 16:25933907-25933929 GGGGCCTGGTGTTTGAGTTATGG - Intronic
1135870607 16:26146553-26146575 GAAGGCAGGTGTATGAGAAGAGG - Intergenic
1136037192 16:27549541-27549563 GAGGCCTGTTGATTGAGTTGGGG - Intronic
1136372156 16:29843276-29843298 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1136459325 16:30399881-30399903 GAGGCCAGCTGTTTGGGAAAAGG + Exonic
1136553526 16:30994649-30994671 GAGGCTGGGTGTTTGTGGAGAGG - Intronic
1137381538 16:48003828-48003850 GATGCCAGGGGTTAGAGAAGGGG + Intergenic
1137686266 16:50389018-50389040 TGGGCCTGGTGTTTGAGGACAGG + Intergenic
1137705996 16:50536156-50536178 GAGGCCTGGGGTGCGAGATGAGG + Intergenic
1137948419 16:52758169-52758191 CAGGCCTGGTGTTTTGGAATGGG - Intergenic
1138022369 16:53496346-53496368 GAGGCCTTGTGTTTGAGGCTGGG - Intronic
1138092040 16:54182723-54182745 GTGGGCTGGTGTGAGAGAAGAGG - Intergenic
1138486421 16:57347753-57347775 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1138758647 16:59517979-59518001 GAGGGCTGGTGTCTGTGAAGAGG + Intergenic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1139619763 16:68128904-68128926 GAGGCCAGGAGTTTGAGACTGGG + Intronic
1139710343 16:68771098-68771120 GCGGGCTGGTGTGTGAGAAAGGG + Intronic
1139816430 16:69677937-69677959 GAGGTCAGGGGTTTGAGATGAGG + Intronic
1139904535 16:70354727-70354749 GAGGCCAGGAATTTGAGAACAGG + Intronic
1140395519 16:74623169-74623191 GAGGCCAGTTGTTTGAGCGGTGG - Exonic
1140720274 16:77765230-77765252 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1140813418 16:78599699-78599721 GATGCCTTGTGTTTAGGAAGTGG + Intronic
1140908569 16:79430627-79430649 CAGGCCTGGTGTTGGTGGAGAGG + Intergenic
1141115649 16:81306616-81306638 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1141425041 16:83939410-83939432 AAGGCCAGGTGTTTGCAAAGAGG + Intronic
1141641673 16:85345082-85345104 GAGGCCTGGGGTTTAGGAGGGGG - Intergenic
1142208954 16:88798562-88798584 GAGGTCAGGAGTTTGAGACGAGG + Intergenic
1142694119 17:1623905-1623927 GAAGCCTGGAGGTTGAGGAGGGG - Intronic
1143458609 17:7084841-7084863 GAGGCCAGGAGTTTGAGACTAGG - Intergenic
1143663123 17:8339538-8339560 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1145958424 17:28871034-28871056 GAGGCCAGGAGTTTGAGATCAGG - Intergenic
1146132033 17:30286215-30286237 CAGGCATGGTTTTTGAGAACTGG - Intronic
1146288809 17:31593805-31593827 GAGGCCTGGTGTGAGAGGCGAGG - Intergenic
1146362615 17:32189930-32189952 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1146710243 17:35034737-35034759 GAGGTCAGGAGTTTGAGATGAGG - Intronic
1147333002 17:39709894-39709916 GAGGCCTGGAGTCAGGGAAGGGG + Intronic
1147349042 17:39825591-39825613 TAGGCTTGGTGTGTGAGAATTGG + Intronic
1147927962 17:43956784-43956806 GAGGCCTTGTGTGTGGGGAGTGG - Intronic
1147983378 17:44289071-44289093 GAGGCCAGGAGTTCGAGACGTGG - Intergenic
1148126549 17:45240426-45240448 GAGGCCTGGTGTGTGTGTGGGGG - Intronic
1148175132 17:45557353-45557375 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1148296239 17:46505674-46505696 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1148936612 17:51168224-51168246 GAGGCCTGGCATTGGAGAGGAGG - Exonic
1149220968 17:54414958-54414980 GAGGGCTGGTGTCTGGGATGAGG - Intergenic
1149489145 17:57069513-57069535 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1149565154 17:57636005-57636027 GAGGGTTGGTGTCTGAGGAGAGG + Intronic
1149592086 17:57837750-57837772 GAGGCCAGGAGTTTGAGACCAGG + Exonic
1149762568 17:59245769-59245791 GAGGCCAGGAGTTTGAGATCAGG + Intronic
1150038407 17:61830145-61830167 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1150049134 17:61941628-61941650 GAGGCCAGGAGTTTGAGACTCGG + Intergenic
1150368399 17:64612452-64612474 GAGGCCAGGAGTTTGAGACCTGG + Intronic
1150406349 17:64904264-64904286 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1150487235 17:65552203-65552225 AAGGCCTCGTAGTTGAGAAGGGG + Intronic
1151317404 17:73331623-73331645 GAGGCCAGGAGTTTGAGACCCGG - Intergenic
1151706646 17:75772652-75772674 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1151894661 17:76971969-76971991 GAGGCCTGCTGTGAGATAAGAGG - Intergenic
1151971596 17:77460280-77460302 GGGCCCTGGTGTTTGTGGAGTGG + Intronic
1152377028 17:79924197-79924219 AAGACATGGTGTTTGAGAGGTGG - Intergenic
1152447018 17:80351267-80351289 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1152454421 17:80405198-80405220 GAGGGCTGGTGTCTGGGATGAGG - Intergenic
1152728002 17:81957095-81957117 GAGGCCAGGTGGCTGGGAAGAGG + Intronic
1153449904 18:5215621-5215643 GAGGACTGGTTTCTGATAAGAGG - Intergenic
1153985276 18:10345247-10345269 GAGGCCTTGTGATTAAGCAGAGG - Intergenic
1154296645 18:13157125-13157147 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1154470882 18:14699847-14699869 GAGGTCAGGAGTTTGAGAAAAGG - Intergenic
1155863370 18:30932712-30932734 GAGCCCAGGTGTTTGAGACCAGG + Intergenic
1156576161 18:38318397-38318419 GAGGCCAGGAGTTTGAGAGCAGG - Intergenic
1156729976 18:40181160-40181182 GAGGTCAGGTGTTTGAGACTAGG + Intergenic
1156916256 18:42466856-42466878 GAGGGCTGGTGTCTGGGATGAGG - Intergenic
1156923678 18:42553388-42553410 GAGGGCTGGTGTCTGGGATGAGG + Intergenic
1157122736 18:44926652-44926674 AAGGGCAGGTGTCTGAGAAGGGG + Intronic
1157200232 18:45653559-45653581 GGGGCCTGGAGTTTGGGGAGGGG - Intronic
1157582454 18:48781452-48781474 GAAATCTGCTGTTTGAGAAGTGG + Intronic
1158394293 18:57067657-57067679 GAGGGCTGGTGTCTGAGATGAGG + Intergenic
1158597116 18:58826315-58826337 GAGGCCAGGTGTTTGAGACCAGG + Intergenic
1158597118 18:58826329-58826351 GAGACCAGGTGTTTGAGACCAGG + Intergenic
1159211661 18:65330701-65330723 AAGGTCTGGTGTTTGATAGGAGG - Intergenic
1159929596 18:74297216-74297238 GAGGGCTGGTGTCTGGGACGAGG - Intergenic
1160345822 18:78131020-78131042 GAGGGCTTGTGTATGAGAGGTGG + Intergenic
1160848861 19:1180151-1180173 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1160975929 19:1792364-1792386 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1161097635 19:2402177-2402199 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1161125446 19:2554766-2554788 GAGGTCAGGTGTTTGAGACCAGG - Intronic
1161223933 19:3133597-3133619 GAGCCCTGGTGTCTGGGAGGAGG + Intergenic
1161336985 19:3719957-3719979 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1161466104 19:4431474-4431496 AAGGCCTGTCGTTTGGGAAGTGG + Intronic
1161980678 19:7628678-7628700 AAGGCCTGGTGTCTGGGAAGAGG - Intronic
1162063934 19:8113210-8113232 GAGGCAAGGAGTTTGAGACGAGG + Intronic
1162187819 19:8919923-8919945 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1162193095 19:8962514-8962536 AAGGACAGGTGCTTGAGAAGAGG + Exonic
1162273696 19:9636653-9636675 GAGGGCTGGTGTCTGGCAAGAGG + Intronic
1162370164 19:10273798-10273820 GAGGCCAGGAGTTTGAGAGCAGG + Intronic
1162815511 19:13191866-13191888 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1162845219 19:13387162-13387184 GAGGTCAGGAGTTTGAGAACAGG - Intronic
1162867213 19:13557201-13557223 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1162891906 19:13739615-13739637 GAGGCCTGGTATGTGGGAAGAGG - Intronic
1163107689 19:15135394-15135416 GAGCCCAGGAGTTTGAGAACTGG + Intergenic
1163253831 19:16142980-16143002 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1163294754 19:16404983-16405005 GAGGCCAGGTGCGAGAGAAGGGG + Intronic
1163528443 19:17835403-17835425 ATGGGGTGGTGTTTGAGAAGGGG - Intronic
1163541207 19:17911785-17911807 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1163899723 19:20090717-20090739 GAGGGCTGGTGTCTGGGATGAGG + Intronic
1163951241 19:20589146-20589168 GAGGCCAGGAGTTTGAGATTAGG + Intronic
1163955979 19:20640933-20640955 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1163965377 19:20741908-20741930 GAGGCCAGGAGTTTGAGATTAGG - Intronic
1164145075 19:22507454-22507476 GAGGCCTGGAGTTTCAGAGCAGG - Intronic
1164220447 19:23188417-23188439 GAGGGCTGGTGTCTGGGATGAGG + Intergenic
1164467424 19:28499721-28499743 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1164754018 19:30676917-30676939 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1164882975 19:31751430-31751452 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1165064498 19:33221086-33221108 GAGCCCTGGGCTTTGAGCAGAGG - Intronic
1165348438 19:35263573-35263595 GAGGCCAGGAGTTTGAGATCAGG - Intronic
1166135448 19:40774416-40774438 GAGCCCAGGAGTTTGAGACGAGG + Intronic
1166755635 19:45189231-45189253 GAGGTCAGGAGTTTGAGACGAGG - Intronic
1166831967 19:45644637-45644659 GAGGCCTGGTCTCTGGGAAAAGG - Intronic
1167345971 19:48946036-48946058 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1167355000 19:48998268-48998290 AAGGCCTGGTGGTTGAGAACTGG + Intronic
1167379883 19:49132696-49132718 AAGGCCTGGGTTTTGAGGAGAGG + Intronic
1168287025 19:55340219-55340241 GAGGCCTGGAGAGTGACAAGAGG - Intronic
1168287082 19:55340387-55340409 GAGGCCTGGAGGGTGAGAGGAGG - Intronic
1202697239 1_KI270712v1_random:133989-134011 GAGGCCAGGAGTTTGAGAACAGG - Intergenic
925776835 2:7344066-7344088 GAGGCATGGTCTTTGGGATGAGG + Intergenic
926206756 2:10839464-10839486 GAGGTGGGGTCTTTGAGAAGTGG - Intergenic
926240342 2:11080529-11080551 GAGGCCAGGTGGCTGAGAAGTGG + Intergenic
926448750 2:12976178-12976200 GAGGCCAGAAGTTTGAGAACAGG + Intergenic
926492113 2:13537509-13537531 GAGGACAGTTGTTTGAGGAGGGG + Intergenic
926754368 2:16223649-16223671 GAGGCCTGATGTCTGAACAGAGG + Intergenic
927095608 2:19745729-19745751 CAGGTGTGGTGTTTGGGAAGTGG + Intergenic
927545156 2:23946043-23946065 GAGGCCAGGAGTTTGAGACCAGG - Intronic
927751857 2:25676503-25676525 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
927807126 2:26158044-26158066 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
928192655 2:29187508-29187530 CAGGCCAGGTGTTTGAGAGCAGG - Intronic
928245563 2:29624145-29624167 CAGGACTGGTGTTTGAGCAAAGG - Intronic
929442202 2:41973097-41973119 CAGGGCTGGGGTTTGAGTAGAGG + Intergenic
929524394 2:42686903-42686925 GAGGCCAGGAGTTTGAGACCAGG + Intronic
930757513 2:54992108-54992130 GAGGCCAGGAGTTTGAGACCAGG + Intronic
930786257 2:55274226-55274248 GAGGCCAGGAGTTTGAGACCTGG + Intergenic
931410540 2:62025905-62025927 GAGGCCAGGAGTTTGAGACCAGG - Intronic
931615030 2:64146824-64146846 GAAGCATGGAGTCTGAGAAGTGG + Intergenic
931657036 2:64518628-64518650 AAGGGCTGGTTTTTGGGAAGGGG + Intergenic
931692185 2:64844758-64844780 GAGAGATGGTGTTTTAGAAGAGG + Intergenic
931726576 2:65117275-65117297 GAGGCCAGGAGTTTGAGACCTGG - Intronic
932465682 2:71922662-71922684 CAGGCCTGGTGGATTAGAAGGGG - Intergenic
932475398 2:72002864-72002886 GAGGCCGGGAGGTCGAGAAGTGG - Intergenic
933909222 2:86924367-86924389 GAGGCCAGGAGTTTGAGACCAGG - Intronic
933928813 2:87126949-87126971 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
933946335 2:87288976-87288998 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
934000146 2:87702734-87702756 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
934023502 2:87979018-87979040 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
934278408 2:91591014-91591036 GAGGCCAGGAGTTTGAGAACAGG - Intergenic
934685527 2:96318524-96318546 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
934763476 2:96868651-96868673 GAGGGCTGGTGTTTCGGAGGAGG - Intronic
935203909 2:100881470-100881492 GAGGCCAGGAGTTTGAGACCAGG + Intronic
935295009 2:101641272-101641294 GAAGCCAGGAGTTTGAGATGAGG + Intergenic
936333859 2:111572557-111572579 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
937134609 2:119542134-119542156 GAGCCCAGGAGTTTGAGAGGAGG - Intergenic
938390101 2:130898314-130898336 CAGGCCTGGTGGTGAAGAAGCGG + Intronic
939013534 2:136875206-136875228 GAGGCCAGGAGTTTGAGACCAGG + Intronic
940643063 2:156367354-156367376 GAGGCCAGGAGTTTGAGACTTGG + Intergenic
940940623 2:159556673-159556695 GAGGCCAGGAGTTTGAGAACAGG - Intronic
941063580 2:160875799-160875821 CAGGCCTGCTGTCTTAGAAGGGG + Intergenic
941455706 2:165710592-165710614 GAGGGCTGGTGTCTGGGATGAGG + Intergenic
941618994 2:167755752-167755774 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
942267337 2:174241847-174241869 GAGGTCAGGAGTTTGAGAACAGG - Intronic
942957706 2:181793297-181793319 GAGGTTTGGTGTGGGAGAAGGGG + Intergenic
943070645 2:183136874-183136896 GAGGCCAGGAGTTTGAGACCAGG + Intronic
943203451 2:184860242-184860264 GAGGCTTGGTCTGTGAGAACTGG + Intronic
943412503 2:187560952-187560974 GAGGGCTGGTGTCTGTGATGGGG + Intronic
943481018 2:188418025-188418047 GAGGCCTGGAGTTTGAGACGTGG - Intronic
943626728 2:190209674-190209696 GAGGACTGGTCTTTGAAAAAGGG - Intronic
943949811 2:194119220-194119242 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
944251619 2:197584791-197584813 GAGGACTGGTGTCTGGGATGAGG - Intronic
944500866 2:200358772-200358794 GAGGCCAGGAGTTTGAGACCAGG + Intronic
944603242 2:201324912-201324934 GAGGCCAGGAGTTTGAGACCAGG + Intronic
944734066 2:202545214-202545236 GAGGCCAGGTGTGTGGGGAGGGG - Intronic
944851676 2:203725993-203726015 GAGGCCAGGAGTTTGAGACCAGG + Intronic
945816899 2:214616275-214616297 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
945983413 2:216334612-216334634 GAGGCCAGGAGTTTGAGACCAGG - Intronic
946071365 2:217036909-217036931 GAGGTCGGGAGTTTGAGAACAGG - Intergenic
946943580 2:224796140-224796162 GAGGCCAGGAGTTTGAGTTGAGG - Intronic
947259946 2:228209731-228209753 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1169133624 20:3182006-3182028 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1169167727 20:3438691-3438713 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1169711625 20:8571004-8571026 GAGCCATGGTGTATGAAAAGTGG + Intronic
1170968079 20:21094024-21094046 GAGGTGTGGTATTTGGGAAGGGG + Intergenic
1171123951 20:22586057-22586079 GAGTCCTGGGGTTAGGGAAGTGG - Intergenic
1171167416 20:22984215-22984237 GAGACTTGGTTTCTGAGAAGAGG - Intergenic
1171314362 20:24175901-24175923 GAGGCCTGGTGATAGAGAATAGG + Intergenic
1171400089 20:24867517-24867539 GTGACCTGGTGTGTGTGAAGAGG - Intergenic
1171494900 20:25548725-25548747 GAGGCCGGGTGTGGGAGATGTGG - Intronic
1171521121 20:25774766-25774788 TAGGCCTGGTGCTGGTGAAGTGG - Exonic
1172025216 20:31943763-31943785 TAGGCCTTGTGTTTGAGATTGGG + Exonic
1174367959 20:50067802-50067824 GGTGCCTGATGCTTGAGAAGTGG - Intergenic
1174617719 20:51849085-51849107 GAGGCCAGGAGTTTGAGAGCAGG - Intergenic
1174846688 20:53949602-53949624 GAGGCTTGGTCTTTGGAAAGCGG + Intronic
1175118706 20:56702242-56702264 GAGATCTGGTGCTTTAGAAGTGG - Intergenic
1175162164 20:57016870-57016892 GAGGCCAGGAGTTTGAGAATAGG + Intergenic
1175567244 20:59990025-59990047 GAGGCCAGGAGCTGGAGAAGGGG - Intronic
1176803601 21:13458082-13458104 GAGGTCAGGAGTTTGAGAAAAGG + Intergenic
1177072547 21:16528410-16528432 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1177645795 21:23898763-23898785 AATCCCTGGTGTTGGAGAAGGGG - Intergenic
1178119210 21:29450976-29450998 GAGGCCGGGAGTTTGAGACTAGG + Intronic
1178289488 21:31354799-31354821 GATGCCTGGTTTCTGAGAAAGGG + Intronic
1178740330 21:35194125-35194147 GAGGTCTGATGGTTGAAAAGTGG - Intronic
1178808256 21:35857600-35857622 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1179270806 21:39849646-39849668 AAGGCCTGGTGCTTGAGAGATGG - Intergenic
1182130745 22:27848773-27848795 GAGTCCTGGGGTTCGAGCAGAGG - Intergenic
1182293803 22:29301417-29301439 GGGGGCTGGGGTTTGAGAATGGG - Intergenic
1182525396 22:30914197-30914219 GAAGCCAGGTGTTTGAGACCAGG + Intergenic
1182724970 22:32437602-32437624 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1183076758 22:35432313-35432335 GAGGCCTGGTGTGTGGGTACCGG + Intergenic
1183084355 22:35477465-35477487 GATGCCTGGAGTTGGAGAGGAGG - Intergenic
1183310276 22:37105861-37105883 GAGGCCAGGTGTTTGAGACCTGG - Intronic
1183446787 22:37862047-37862069 GAGGCCAGGAGTTTGAGAACAGG - Intronic
1183507402 22:38216967-38216989 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1183580335 22:38721428-38721450 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1183735020 22:39640173-39640195 GAGGTCAGGAGTTTGAGAACAGG + Intronic
1184104101 22:42357531-42357553 GAGCCCTGGAGTGTGAGAGGTGG - Intergenic
1184788367 22:46683186-46683208 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1185151808 22:49168015-49168037 GAGGGGTGGTGTGTGGGAAGAGG - Intergenic
1185259822 22:49855253-49855275 GAGGCCCGGTCTTTGAGGTGAGG + Intronic
949671520 3:6402354-6402376 GAGGGCTGGTGTCTGGGATGAGG - Intergenic
949767063 3:7538323-7538345 GAGGTCTGGAGTTTGAGACCAGG - Intronic
949815278 3:8051784-8051806 GATGCCTGGTGTATAAAAAGTGG - Intergenic
950034350 3:9874300-9874322 GAGGCCAGGAGTTTGAGACCAGG + Intronic
950770455 3:15306884-15306906 GAGGCCAGGAGTTTGAGACCAGG - Intronic
950985738 3:17363624-17363646 GAGGCCAGGAGTTTGAGATCAGG - Intronic
951840969 3:27033775-27033797 GAGGTCTGATGTTTGAGAGCAGG - Intergenic
952297364 3:32073193-32073215 GAGGGCTGGTGTCTGGGATGAGG - Intronic
952566785 3:34668763-34668785 GCTGCCTGGTGTTGGAGGAGGGG - Intergenic
952912734 3:38204383-38204405 GACTCCTTCTGTTTGAGAAGAGG - Intronic
953208349 3:40851947-40851969 GAGGCCTTGTGTGTCAGATGGGG + Intergenic
953805472 3:46064084-46064106 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
953884235 3:46706490-46706512 GAGGTCTGGAGTTGGGGAAGGGG + Intronic
954009793 3:47625942-47625964 GAGGCCAGGAGTTTGAGACCAGG + Intronic
954161208 3:48723960-48723982 GAGGGCTGGTGTCTGGGACGAGG + Intronic
955304566 3:57816912-57816934 GAGGCCTGGGGCTTGTGCAGGGG + Intronic
955397998 3:58570942-58570964 GAAGCCTGGTGTTTGAAATGGGG - Intronic
955703580 3:61705794-61705816 GAGGACTGATGCTTGAGCAGAGG + Intronic
956059692 3:65336952-65336974 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
956683598 3:71804212-71804234 GAGGTCAGGAGTTTGAGACGAGG - Intergenic
956791198 3:72681241-72681263 GAGCCCTGGAGGATGAGAAGGGG - Intergenic
957455424 3:80437412-80437434 GAGGCCAGGAGTTTGAGACAAGG + Intergenic
959365793 3:105455874-105455896 GAGGCCAGGAGTTGGAGAACAGG + Intronic
960098779 3:113715684-113715706 GAGGCCAGAAGTTCGAGAAGAGG + Intergenic
960706427 3:120486579-120486601 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
960779873 3:121308094-121308116 GGGGCCTGTTGTTGGAGCAGGGG + Intronic
960943125 3:122947420-122947442 GAGGCCTAGGATTTGAGAGGTGG - Intronic
961026977 3:123566681-123566703 GAGGCCAGGAGTTTGAGACCAGG + Intronic
961234657 3:125355671-125355693 GAGGCCAGGTGTTTGAGACCAGG + Intronic
962608507 3:137052681-137052703 GAGGCCAGGTGTTTGAGACCAGG + Intergenic
962769472 3:138599197-138599219 GAGGCCGGGAGTTTGAGACCAGG - Intergenic
963386353 3:144599266-144599288 GAGACCTGGTGGTTTATAAGGGG - Intergenic
963758557 3:149260809-149260831 GAGGCCAGGAGTTTGAGACTAGG + Intergenic
963984962 3:151581855-151581877 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
964030174 3:152129392-152129414 GAAGCCTTGTTTTTGAGAATTGG - Intergenic
964467571 3:157013193-157013215 GAGCTCAGGAGTTTGAGAAGAGG - Intronic
964760154 3:160127798-160127820 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
965458554 3:168932726-168932748 GAGGGCTGGTGTCTGGGAAGAGG + Intergenic
965761667 3:172084233-172084255 GAGGCCAGGAGTTTGAGACCAGG + Intronic
965991799 3:174827967-174827989 GAGGCCAGGAGTTTGAGAGAAGG + Intronic
967036385 3:185651419-185651441 GAGCCCAGGAGTTTGAGAACAGG - Intronic
967478661 3:189949422-189949444 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
967516249 3:190372427-190372449 GAGGCCAGGAGTTTGAGACAAGG + Intronic
968630767 4:1649813-1649835 CAGGCATGGTGTTTGTGAGGTGG + Intronic
968630775 4:1649867-1649889 CAGGCGTGGTGTTTGTGAGGTGG + Intronic
968630803 4:1650066-1650088 CAGGCGTGGTGTTTGTGAGGTGG + Intronic
968630814 4:1650149-1650171 CAGGCGTGGTGTTTGTGAGGTGG + Intronic
968630833 4:1650290-1650312 CAGGCGTGGTGTTTGTGAGGTGG + Intronic
969032348 4:4225354-4225376 GAGGCCAGGAGTTTGAGAAAAGG + Intronic
969229236 4:5818138-5818160 GAGGTCTGATGGTTTAGAAGGGG + Intronic
970043285 4:11821037-11821059 GAGGCATGATGTTAGAGAATTGG - Intergenic
970565979 4:17333152-17333174 GACTCCTGGTGTTTTAGAAAGGG + Intergenic
972619055 4:40729166-40729188 GAGGCCAGGAGTTTGAGACCTGG + Intergenic
973169421 4:47120924-47120946 GCTGCCTGGTGTTGAAGAAGGGG + Intronic
974416666 4:61616866-61616888 GAGGCCAGGAGTTTGAGATCAGG - Intronic
974933985 4:68391990-68392012 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
975328020 4:73081930-73081952 GAGGCCAGGAGTTTGAGATCAGG + Intronic
975664507 4:76721547-76721569 GAGGGCTTTTATTTGAGAAGGGG + Intronic
975788789 4:77924537-77924559 GAGGACTGCTTTGTGAGAAGGGG - Intronic
975912481 4:79283411-79283433 GAGACCTGGGCTTTGATAAGAGG + Intronic
976721230 4:88170623-88170645 GAGGGCAGGGGTTTCAGAAGAGG - Intronic
977655170 4:99513370-99513392 GAGGCCTGGAGTGAGAGCAGAGG + Intronic
978116413 4:105024850-105024872 GCAGCCTGGGGTTAGAGAAGGGG - Intergenic
978648326 4:110969412-110969434 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
978808841 4:112828938-112828960 GAGGCCAGGAGTTTGAGAACAGG + Intronic
979832076 4:125315824-125315846 GCAGCCTGGTTTTTGAGGAGTGG + Intergenic
979979524 4:127237481-127237503 AAGGCCAAGTGTTTGAGATGTGG - Intergenic
981050464 4:140304706-140304728 GAAGGCTGGTCTTTGGGAAGGGG + Intronic
981218184 4:142196909-142196931 GAGGCCAGGAGTTTGAGACCAGG + Intronic
981628280 4:146786897-146786919 GAGGCTAGGTGTTTGAGACCAGG + Intronic
981722974 4:147820111-147820133 GAGCCATGGTGTTGGAGGAGTGG + Intronic
981841486 4:149118100-149118122 GTGGACTGGTAATTGAGAAGGGG - Intergenic
984087554 4:175331323-175331345 GAAGCCTGGGATTTGAGAAAGGG + Intergenic
984164670 4:176293097-176293119 GAGGGAAGGTGCTTGAGAAGTGG + Intergenic
984238953 4:177194068-177194090 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
984436072 4:179711885-179711907 GAAGCCTGGGGCTTGAGAATGGG - Intergenic
986048691 5:4066234-4066256 GAGGCATGTGGTATGAGAAGGGG + Intergenic
986256306 5:6103794-6103816 AAGGCCTGGTGTGGGAGAAGGGG - Intergenic
986269814 5:6220658-6220680 GAGGCCTGGAGTCTGAGATCGGG + Intergenic
986401095 5:7381698-7381720 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
988522460 5:31958839-31958861 GAGGTCAGGAGTTTGAGAAGAGG - Intronic
988678561 5:33460183-33460205 GAGGCCAGGAGTTTGAGACCAGG - Intronic
988772950 5:34450263-34450285 GATGCCTGGGGTGTAAGAAGAGG - Intergenic
989076440 5:37568258-37568280 CAGGTGTGGTGTTTGGGAAGTGG + Intronic
990310696 5:54535307-54535329 TAGGACTGGTGATGGAGAAGTGG + Intronic
990543246 5:56795801-56795823 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
990826816 5:59909596-59909618 GAGTCCAGGTGTTTGAGACAAGG - Intronic
991154297 5:63412840-63412862 GAGGCCAGGGGTTTGAGACCAGG - Intergenic
992087720 5:73292994-73293016 GAGGCCAGAAGTTGGAGAAGGGG + Intergenic
992227979 5:74637305-74637327 GAGGCCAGGAGTTTGAGACCCGG - Intronic
993846174 5:92946645-92946667 GAGGTCAGGTGTTTGAGACCAGG + Intergenic
993967630 5:94376871-94376893 GCGGCCTGGTTATGGAGAAGTGG - Intronic
994276727 5:97847328-97847350 GAGGCCTGGTGTAAGAAAACGGG - Intergenic
995958687 5:117812431-117812453 TAGGGCTGGTGTTTGAGACAAGG + Intergenic
996051276 5:118936589-118936611 GAGGCCAGGAGTTTGAGACGAGG + Intronic
996290339 5:121845046-121845068 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
996358263 5:122619909-122619931 GAGGGCTGGTGTCTGGGATGAGG + Intergenic
996936598 5:128956688-128956710 GAGGTGTGCTGTTTGAGAATTGG - Intronic
997250887 5:132387741-132387763 GAGTCATGGTGTGTGAGAACAGG - Intronic
997263132 5:132478801-132478823 GAGGCCTGGGGTGGGAGAAGGGG - Intergenic
997370056 5:133353837-133353859 GAGGCCAGTTCTTTGAGCAGCGG + Intronic
998428746 5:142051954-142051976 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
998558553 5:143149459-143149481 ACTGCCTGGGGTTTGAGAAGTGG - Intronic
999159191 5:149481269-149481291 GAGCCCAGGTGTTTGAGATCAGG + Intergenic
999218691 5:149957550-149957572 GAGGCCAGGAGTTTGAGATCAGG + Intergenic
999284206 5:150384410-150384432 CAGACCTGGTGTTTGAGCACAGG + Intronic
999632226 5:153583009-153583031 GAGGTCAGGAGTTTGAGATGAGG - Intronic
999723368 5:154415550-154415572 GAGGCCAGGAGCTTGAGAACAGG - Intronic
999758996 5:154685755-154685777 GAGGCCGGGAGTTTGAGATCAGG + Intergenic
1000607321 5:163338792-163338814 GAGGGCTGGTGTCTGGGACGAGG - Intergenic
1001033692 5:168281432-168281454 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1002418450 5:179132970-179132992 GAGGCCAGGTGTTCGAGACTGGG - Intronic
1003174204 6:3743255-3743277 GAGGCCTGTTCTTTGGGTAGTGG - Intronic
1003283360 6:4712929-4712951 GAGGCCAGGCGTTTGAGACCAGG + Intronic
1003503422 6:6721270-6721292 GAGGGCTGGTCCTGGAGAAGTGG + Intergenic
1004005405 6:11633258-11633280 GAGGGCTGGAGTTTGAGTAGAGG + Intergenic
1004686603 6:17952417-17952439 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1005187625 6:23180873-23180895 GAAGCCTGGTGGTGGAGATGGGG - Intergenic
1006043387 6:31272352-31272374 GATGCTTGGTGTAGGAGAAGAGG - Intronic
1006052969 6:31357443-31357465 GAGGCTTGGTGTAGGAGAAGAGG - Intergenic
1006433720 6:34014926-34014948 GAGGCCTAGCATTTGAGGAGTGG + Intergenic
1006852132 6:37106441-37106463 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1007597646 6:43061340-43061362 CAGGCCTGGTGTTGGGGCAGCGG + Exonic
1007661509 6:43489650-43489672 GAGGACGGCTGTTGGAGAAGGGG - Intronic
1008369958 6:50720832-50720854 GAGGCCGGCTGTGGGAGAAGCGG - Intronic
1009563560 6:65278973-65278995 GAGGTCAGGAGTTTGAGAACAGG + Intronic
1010123983 6:72411750-72411772 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1010586265 6:77661023-77661045 GAGGGCTGGTGTCTGGGATGAGG + Intergenic
1010761234 6:79725510-79725532 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1011379500 6:86727361-86727383 GAGCCCTGGTGTTTTTGTAGTGG - Intergenic
1012255909 6:97031549-97031571 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1012943603 6:105442831-105442853 GAGAGCTTGTGTTGGAGAAGTGG - Intergenic
1013330294 6:109094526-109094548 GGGGACTGGTGTCGGAGAAGGGG - Exonic
1013557084 6:111267405-111267427 AAGGCATTGTTTTTGAGAAGGGG + Exonic
1014180849 6:118382760-118382782 GAGGCCAGGAGTTTGAGACTTGG - Intergenic
1015367206 6:132409481-132409503 GAGGCCAGGGGTTTGAGACCAGG + Intergenic
1015408896 6:132869694-132869716 GAGGCCAGGAGTTTGAGATGGGG - Intergenic
1015893872 6:137998065-137998087 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1015919189 6:138249609-138249631 GAGGTCAGGAGTTTGAGAATAGG + Intronic
1016007603 6:139105489-139105511 GAGGCCGGGTGTTCGAGACCGGG + Intergenic
1016012206 6:139148974-139148996 GCAGCCTGGTTCTTGAGAAGAGG - Intronic
1016515645 6:144890749-144890771 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1016882175 6:148921926-148921948 GATGCTGGGTGTTTGAGGAGAGG - Intronic
1016912160 6:149209738-149209760 GGGGCCTGGTGTTTGAGCCATGG - Intergenic
1017160554 6:151361697-151361719 GAGGCCTGGAGGTTGAGAGGAGG + Intergenic
1017254677 6:152319943-152319965 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1017256144 6:152335898-152335920 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1017922392 6:158883666-158883688 GAGGGCTGGTGTCTGGGACGAGG + Intronic
1018483005 6:164210905-164210927 GAGGCCTGAAGCTTGAGAGGAGG + Intergenic
1018753504 6:166828286-166828308 GAGGGCAGGTCTTTCAGAAGAGG - Intronic
1020653900 7:10907797-10907819 GAGGTCAGGAGTTTGAGAACAGG + Intergenic
1020832750 7:13111814-13111836 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1021695101 7:23268821-23268843 GAGGCCTGGCTGGTGAGAAGGGG + Intronic
1022013775 7:26330804-26330826 GAGCCCTGGAGTTTGAGACCAGG + Intronic
1022373221 7:29789516-29789538 GAGGGCTGGTGTCTGGGATGAGG - Intergenic
1023459354 7:40378174-40378196 GAGGACAGGGGATTGAGAAGTGG - Intronic
1023707089 7:42952434-42952456 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1023796928 7:43801208-43801230 GAGCCCAGGAGTTTGAGATGAGG - Intronic
1024873250 7:53990843-53990865 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1025614224 7:63104503-63104525 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1025641884 7:63381664-63381686 GAGGCCTGGAGTTTGAAACCAGG - Intergenic
1025790653 7:64684257-64684279 GAGGACTGGTGTCTGGGATGAGG - Intronic
1025796602 7:64743633-64743655 GAGGTCAGGAGTTTGAGAACAGG + Intergenic
1025929220 7:65981448-65981470 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1026261341 7:68758511-68758533 GAGGCTTGGAGTTTGAGACCAGG + Intergenic
1026464440 7:70641708-70641730 GAGGCTGGGTGTCTGAGAATTGG - Intronic
1026594924 7:71726479-71726501 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1027186207 7:75972220-75972242 GAGCCCTGGTGTTGGATTAGAGG + Intronic
1028234661 7:88346345-88346367 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1029163637 7:98570654-98570676 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1029429457 7:100520997-100521019 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1029467722 7:100736724-100736746 GATGCCTGGGCTCTGAGAAGGGG + Intronic
1029567367 7:101348043-101348065 GAGCCCAGGAGTTTGAGAACAGG - Intergenic
1029572914 7:101382830-101382852 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1030947379 7:115740528-115740550 GAGGCCAGGAGTTTGAGACCAGG + Intergenic
1031127574 7:117791951-117791973 TATGCCTGGTGTTTGAGCGGTGG + Exonic
1032036407 7:128524794-128524816 CAGGCCTGGGGGTTGTGAAGAGG + Intergenic
1032206464 7:129870155-129870177 GAGGCCTGGTGTTTGAGAAGAGG - Intronic
1032317047 7:130847879-130847901 GAGGCCAGGAGTTTGAGACCGGG - Intergenic
1032359388 7:131241162-131241184 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1032921812 7:136557599-136557621 GAGGGTTGGTGTTTGAGGAGAGG + Intergenic
1033029739 7:137814214-137814236 GAGCCCTGCTGTTAGAGAAAAGG - Intronic
1035236911 7:157503212-157503234 GATGCCTGGTGTTTTTGGAGGGG + Intergenic
1036091715 8:5672827-5672849 GAGTGCTGGTGGTTGAAAAGTGG + Intergenic
1036184129 8:6609723-6609745 GAGGCCTGGGAAATGAGAAGTGG - Intronic
1036428917 8:8671495-8671517 GAGGCCAGTTGTTGGGGAAGAGG + Intergenic
1036492819 8:9243682-9243704 CACGGCAGGTGTTTGAGAAGGGG + Intergenic
1036570295 8:9974379-9974401 GAGGCCTGGCTTCTGAGATGCGG + Intergenic
1036601138 8:10261480-10261502 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1037574529 8:20188637-20188659 GAGCCCTGGTGCTTCAGAATGGG + Intergenic
1037866993 8:22452251-22452273 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1038174387 8:25166839-25166861 CAGGTCTGGAGGTTGAGAAGTGG - Intergenic
1038655132 8:29443820-29443842 GAGCCCAGGAGTTTGAGACGAGG - Intergenic
1039879501 8:41615673-41615695 GAGGCCTGGTGGATGTGAAGAGG - Intronic
1040430808 8:47340389-47340411 GAGGTCAGGAGTTTGAGATGAGG + Intronic
1041412809 8:57575250-57575272 GCAGCTTGGTGTTTGGGAAGAGG + Intergenic
1042788853 8:72581017-72581039 GGGGCACTGTGTTTGAGAAGTGG - Intronic
1042789054 8:72582831-72582853 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1042876328 8:73443636-73443658 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1044916870 8:97122669-97122691 GAGGTCCGGAGTTTGAGAACAGG + Intronic
1044967621 8:97588328-97588350 GTGGCCTGGTGTTTGAGAGCAGG - Intergenic
1045168749 8:99639755-99639777 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1045249049 8:100467951-100467973 GAGGAATGAGGTTTGAGAAGGGG - Intergenic
1046317968 8:112531476-112531498 GCTGCCTGGAGTTTGGGAAGGGG - Intronic
1046619326 8:116511770-116511792 GAGACTTGGTGGTTGGGAAGGGG + Intergenic
1048395423 8:134009976-134009998 GAGCCCTGGAGTTTGAGACCAGG + Intergenic
1049235911 8:141512218-141512240 CAGCCCTGGAATTTGAGAAGTGG + Intergenic
1049235917 8:141512249-141512271 GTGCCCTGGAATTTGAGAAGTGG + Intergenic
1049235923 8:141512280-141512302 GTGCCCTGGAATTTGAGAAGTGG + Intergenic
1049235934 8:141512342-141512364 GTGCCCTGGAATTTGAGAAGTGG + Intergenic
1050057759 9:1673561-1673583 GAGAGCTGGTTTTTGAAAAGAGG - Intergenic
1050453268 9:5806651-5806673 GAGGCCAGGTGTTTGAGACCAGG - Intronic
1050487211 9:6146955-6146977 GAGGCAAGGTGTTGGGGAAGGGG + Intergenic
1051112944 9:13660909-13660931 TAGGCCTGGGGTTGGAGAACAGG - Intergenic
1051153573 9:14114276-14114298 GAGGCTTGGAGATTGAGTAGGGG - Intronic
1052068275 9:24049947-24049969 GAGGTCTGGAGATAGAGAAGAGG + Intergenic
1052670112 9:31546158-31546180 GAGGTCAGGAGTTTGAGAACTGG - Intergenic
1053113138 9:35479708-35479730 GAGGACTGGAGCTTGAGATGGGG - Intergenic
1055007728 9:71527730-71527752 GTGGGCTGGTCTTAGAGAAGAGG - Intergenic
1056150338 9:83781147-83781169 GAGGCCAGGAGTTTGAGACCAGG + Intronic
1056267655 9:84915419-84915441 GAGCCCTGGTTGTTGAAAAGTGG + Intronic
1056324317 9:85463887-85463909 GAGGGCTGGTGTCTGGGATGAGG - Intergenic
1056454772 9:86749259-86749281 GAGGTCTGGAGTATGAGGAGGGG - Intergenic
1057215033 9:93223311-93223333 CAGGCATGATGTTTGAGCAGTGG - Intronic
1057558697 9:96110314-96110336 GAGGCCAGGAGTTGGAGAACAGG - Intronic
1058039613 9:100289530-100289552 GAGCCCAGGTGATCGAGAAGAGG - Intronic
1058525412 9:105852622-105852644 GAGACCTGATGGTTTAGAAGCGG - Intergenic
1058767742 9:108198431-108198453 GAGGCCTGGGGTTAGGGGAGGGG - Intergenic
1059312126 9:113395842-113395864 GAGGTCTGGAGTTTGAGACCAGG + Intronic
1059357792 9:113713779-113713801 GAGGCCAGGTGTTTGAGACCAGG + Intergenic
1059508237 9:114819342-114819364 GAGCCCAGGGGTTTGAGACGAGG + Intergenic
1060399366 9:123339272-123339294 GGGGCATGGTGTTTGACAGGTGG - Intergenic
1060632039 9:125167811-125167833 GAGGTCAGGAGTTTGAGATGGGG + Intronic
1061053872 9:128211557-128211579 GAGGCCAGGAGTTTGAGACCTGG - Intronic
1061273816 9:129558331-129558353 GTGGCCTGGTGGCTGAGGAGGGG - Intergenic
1062490835 9:136804165-136804187 GAGGCCAGGTTTTGGGGAAGAGG + Intronic
1186919556 X:14263006-14263028 GAGGCCAGGAGTTTGAGACCAGG - Intergenic
1188961389 X:36496679-36496701 GAGGCCAGGAGTTTGAGACAAGG + Intergenic
1189900917 X:45705620-45705642 CAGTCCTGGTTTTTGAGTAGTGG - Intergenic
1190092459 X:47451538-47451560 GAGGCCAGGAGTTTGAGACATGG + Intronic
1190789771 X:53687450-53687472 GAGGGCTGGAATTAGAGAAGTGG - Intergenic
1190958167 X:55217817-55217839 CAGGCCAGGAGTTTGAGAACAGG - Intronic
1191764156 X:64678719-64678741 CAGTCCTGGAGTTTGAGAACAGG - Intergenic
1191852661 X:65597260-65597282 GAGTCCTGGAGTTTGAGACCAGG - Intronic
1192382073 X:70627491-70627513 GATTCCTGGTGTGTGAGTAGAGG + Intronic
1192731079 X:73803227-73803249 GAGGACTGGTGTCTGAGACGAGG + Intergenic
1192764028 X:74124552-74124574 GAGGGCTGGTGTCTGTCAAGAGG + Intergenic
1193130629 X:77915932-77915954 GAGGCCAGGAGTTTGAGACCAGG - Intronic
1193738305 X:85186296-85186318 GCTGCCTGGTGTTGGGGAAGGGG + Intergenic
1194613815 X:96076459-96076481 GAGTCCTGGAGTTTGAGACCAGG - Intergenic
1195921900 X:109992099-109992121 GAGGCCAGGAGTTTGAGACCTGG + Intergenic
1196799609 X:119530968-119530990 GAGGTCAGGAGTTTGAGAAGCGG - Intergenic
1197428880 X:126334230-126334252 GAGGCCAGGAGTTTGAGACATGG + Intergenic
1197826471 X:130595682-130595704 GAGGTCAGGAGTTTGAGAACAGG + Intergenic
1198077292 X:133205734-133205756 GAGCCCAGGAGTTTGAGAAAAGG + Intergenic
1200042625 X:153380929-153380951 GAGGCCTCGAGATTGAGAACTGG - Intergenic
1200177956 X:154131253-154131275 GAGGCCAGGTGTTCGAGAGTAGG - Intergenic