ID: 1032207316

View in Genome Browser
Species Human (GRCh38)
Location 7:129878930-129878952
Sequence CAGATCTATCTGATTGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 102}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032207316_1032207319 -3 Left 1032207316 7:129878930-129878952 CCACCTTCAATCAGATAGATCTG 0: 1
1: 0
2: 1
3: 14
4: 102
Right 1032207319 7:129878950-129878972 CTGTCACTGAGTGCCTCAATGGG 0: 1
1: 0
2: 2
3: 7
4: 110
1032207316_1032207318 -4 Left 1032207316 7:129878930-129878952 CCACCTTCAATCAGATAGATCTG 0: 1
1: 0
2: 1
3: 14
4: 102
Right 1032207318 7:129878949-129878971 TCTGTCACTGAGTGCCTCAATGG 0: 1
1: 0
2: 1
3: 17
4: 194
1032207316_1032207320 -2 Left 1032207316 7:129878930-129878952 CCACCTTCAATCAGATAGATCTG 0: 1
1: 0
2: 1
3: 14
4: 102
Right 1032207320 7:129878951-129878973 TGTCACTGAGTGCCTCAATGGGG No data
1032207316_1032207322 6 Left 1032207316 7:129878930-129878952 CCACCTTCAATCAGATAGATCTG 0: 1
1: 0
2: 1
3: 14
4: 102
Right 1032207322 7:129878959-129878981 AGTGCCTCAATGGGGGTGACAGG 0: 1
1: 0
2: 0
3: 7
4: 81
1032207316_1032207324 28 Left 1032207316 7:129878930-129878952 CCACCTTCAATCAGATAGATCTG 0: 1
1: 0
2: 1
3: 14
4: 102
Right 1032207324 7:129878981-129879003 GTAAATAACATCACCCATTAAGG 0: 1
1: 0
2: 0
3: 35
4: 863
1032207316_1032207321 -1 Left 1032207316 7:129878930-129878952 CCACCTTCAATCAGATAGATCTG 0: 1
1: 0
2: 1
3: 14
4: 102
Right 1032207321 7:129878952-129878974 GTCACTGAGTGCCTCAATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032207316 Original CRISPR CAGATCTATCTGATTGAAGG TGG (reversed) Intronic
905147403 1:35898062-35898084 CATATCCATCTGATGGAACGAGG - Intronic
907260712 1:53216452-53216474 CAGATCTATCTGACTTGAGCTGG - Intronic
907374447 1:54024308-54024330 GAGACCTATCTAATTTAAGGTGG + Intergenic
908840416 1:68274738-68274760 CAGATCTATCTGACTGAACTGGG - Intergenic
913656677 1:120967281-120967303 CAGAGATATTTGATTGAAGGTGG + Intergenic
914007818 1:143748538-143748560 CAGAGATATTTGATTGAAGGAGG + Intergenic
914521230 1:148418529-148418551 CAGAGATATTTGATTGAAGGTGG + Intergenic
914646641 1:149659018-149659040 CAGAGATATTTGATTGAAGGCGG + Intergenic
919329955 1:196158786-196158808 TTGATCTATTTGATTGTAGGTGG - Intergenic
919791932 1:201297298-201297320 CAGATCCTTCTGCCTGAAGGAGG - Intronic
919865900 1:201782698-201782720 CCGATCTGTCTGATTGACAGGGG - Exonic
924143154 1:241047049-241047071 CAGATCTATCTAATTGCAGGGGG + Intronic
1063394841 10:5677264-5677286 TAGATTTATCTGGTGGAAGGAGG - Intergenic
1064872480 10:19954049-19954071 CAGCTGAATCTGATGGAAGGAGG + Intronic
1067747708 10:48948789-48948811 TAGATCTAGCTGATTGCAGAGGG - Intronic
1069140515 10:64817254-64817276 CAGGTATATGTGATAGAAGGAGG + Intergenic
1071229241 10:83565351-83565373 CAGTTCTATCTTATTTAAGTTGG + Intergenic
1072001705 10:91201539-91201561 CAGAGTTATGTGTTTGAAGGTGG + Intronic
1075172789 10:120131420-120131442 AAGATCTATCTGATTCTAGCTGG - Intergenic
1080084658 11:28265009-28265031 CAATTCTATGTGATTGACGGTGG + Intronic
1082160083 11:48880996-48881018 CAGATATTTCTGTTTGATGGAGG + Intergenic
1082162283 11:48899410-48899432 CAGATATTTCTGTTTGATGGAGG - Intergenic
1088815065 11:113415157-113415179 GAGATCTTTGTGACTGAAGGCGG - Intronic
1090264400 11:125344945-125344967 CATATCTATGTTACTGAAGGAGG - Intronic
1090328823 11:125913222-125913244 CAGATCTACCAGACTGAAGCTGG - Intronic
1096547159 12:52348009-52348031 CAGAGATTTGTGATTGAAGGAGG - Intergenic
1098260692 12:68667191-68667213 CACATATGTCTGATTAAAGGTGG - Exonic
1099276634 12:80584740-80584762 CAGATGTATTTGATTGACGTGGG - Intronic
1101978391 12:109383128-109383150 CAGACCTTTCTGATTGAAGTAGG - Intronic
1105363176 13:19739900-19739922 CAGATCTATCTGAATGCTGGAGG + Intronic
1105466987 13:20653192-20653214 CAGATCTATCTGATTCCAGTAGG + Intronic
1106644242 13:31615739-31615761 CAGATTTTTCTGGTTGAAGTGGG + Intergenic
1106998341 13:35514480-35514502 CAGTTTTTTCTGATTGAGGGTGG - Intronic
1107276930 13:38688486-38688508 CAGATCCCTCTGAGTGAAGGAGG - Exonic
1108734183 13:53265229-53265251 CAGAGCCATCTGCTTGAAGAAGG + Intergenic
1111741748 13:92213791-92213813 CAGATCTATCTAATGAAAGCAGG - Intronic
1112586232 13:100721330-100721352 CGGGTCTATCTGCTTGAAGGAGG - Intergenic
1115395967 14:32908674-32908696 CAGAGCTTTCTGTTTGAAAGAGG + Intergenic
1115530156 14:34319635-34319657 CAGATCTATCTCCTTTAATGTGG + Intronic
1117526573 14:56612795-56612817 AAGCTCTATCTTAGTGAAGGAGG - Intronic
1117795649 14:59390738-59390760 AAGATCTTTATGATTGAATGTGG - Intergenic
1120766335 14:88330286-88330308 CCGAGCTATCTGACTGAAGTTGG + Intergenic
1126975752 15:54178222-54178244 CAGATCTGTTTGTTTGAAGTGGG + Intronic
1128442999 15:67730969-67730991 CTCTTCTATCTGATTAAAGGAGG + Intronic
1133480548 16:6166483-6166505 CAGAGATATGTGATGGAAGGAGG - Intronic
1136252162 16:29012446-29012468 CAGATCCACATGATGGAAGGAGG - Intergenic
1138960241 16:62020710-62020732 CAGATATATCTAATTGCAGGTGG - Intronic
1148253566 17:46107814-46107836 CAGATCCATCTAGTTGAAGCAGG - Intronic
1149650228 17:58271924-58271946 CAGGTCTCTCTGCTTCAAGGTGG + Intronic
1151104274 17:71594332-71594354 CAGAGCTATCTAATTGTAGCAGG - Intergenic
1154144172 18:11852421-11852443 CAGAATGATCAGATTGAAGGTGG + Exonic
1155236761 18:23827603-23827625 CTGAACTATCTGATTTAGGGTGG + Intronic
1157692919 18:49698507-49698529 CTGATCTTCCTGAGTGAAGGGGG + Intergenic
1157884791 18:51356367-51356389 CAGATCCATCTTAGAGAAGGTGG + Intergenic
1159910619 18:74142251-74142273 TAGAATTATCTGATTAAAGGAGG - Intronic
1164515905 19:28935031-28935053 CAGATCTTACTGATTGAAAATGG + Intergenic
1166153568 19:40893177-40893199 GAGATCTACCTAAGTGAAGGAGG - Intronic
925814526 2:7734545-7734567 CAGATCTTTCTGTGTCAAGGTGG - Intergenic
927095728 2:19746590-19746612 CAGATCCATGTGAATGAAGGTGG + Intergenic
927408893 2:22802931-22802953 CAGATCTTTCAGATTCAAGAAGG - Intergenic
927608947 2:24516886-24516908 CATATATATGTGGTTGAAGGGGG - Intronic
929148536 2:38727766-38727788 CAAATCTATCTGAGTAAAAGAGG - Intronic
931926623 2:67080380-67080402 CAGATGTTTCTCATTGATGGTGG + Intergenic
932592966 2:73078212-73078234 CAGATCCCTCTGATGTAAGGGGG - Intronic
933299412 2:80525358-80525380 CAGATCATTCAGATTGAAAGAGG - Intronic
935398018 2:102629473-102629495 CAGATCTATGTGGTTTAATGAGG - Intronic
938707225 2:133942856-133942878 AAGATGCATCAGATTGAAGGAGG - Intergenic
939968457 2:148634346-148634368 CAGATCCTTTTGATGGAAGGTGG - Intergenic
941288624 2:163646760-163646782 CACATTAATTTGATTGAAGGTGG + Intronic
941371549 2:164671853-164671875 CAGCTGTATCTGATTGAAACTGG - Intronic
948734906 2:239996183-239996205 CAGATCGAGCCGATTGACGGTGG - Intronic
1169345936 20:4828121-4828143 CAGAAATATCTCATTAAAGGTGG + Intergenic
1169609442 20:7362597-7362619 CAGATCCCTCTGATTGGAAGTGG + Intergenic
1169683307 20:8241853-8241875 GAGATTTAGATGATTGAAGGAGG + Intronic
1178058288 21:28823973-28823995 CAGATCTACTTGATTGGAGGAGG + Intergenic
1178622685 21:34190324-34190346 CAGATTTTTCTGCATGAAGGGGG - Intergenic
1182693918 22:32183544-32183566 CAGATCCATCTGAATTCAGGGGG - Intergenic
960968848 3:123124727-123124749 CACATCTATCTGATGGATAGAGG + Intronic
962246719 3:133801545-133801567 CAGAGCTATGTGAATGAAGAGGG - Intronic
962486893 3:135852531-135852553 AAGAACTTTCTGATGGAAGGAGG - Intergenic
964672173 3:159238680-159238702 TAGAAATATCTGCTTGAAGGAGG + Intronic
973591043 4:52442081-52442103 AAGATATAACTGATTGAATGAGG - Intergenic
974893124 4:67906521-67906543 AAGCTCTATCTGCTTTAAGGGGG + Intergenic
979071393 4:116212462-116212484 CATATCTATCTGAGAGAATGGGG - Intergenic
982781660 4:159497546-159497568 CAGATTTATCTTTTAGAAGGGGG + Intergenic
987363403 5:17126920-17126942 GAGATCTTTGTGATTCAAGGGGG - Intronic
987841827 5:23232125-23232147 TTGATCTATTTGATTGCAGGCGG - Intergenic
996523026 5:124448348-124448370 CAGATCTGTCTGAGAGAAGAGGG - Intergenic
996996898 5:129707693-129707715 AAGATGTATGTGATTGTAGGTGG + Intronic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
999623047 5:153491388-153491410 CATATATATGTAATTGAAGGAGG + Intronic
1001088382 5:168718406-168718428 CAGAGCTAACTGATTCCAGGTGG + Intronic
1002937915 6:1689507-1689529 CAAATGTATCTGATTCAAAGAGG - Intronic
1003140782 6:3469552-3469574 CAGATCTTTCTGATTCCATGGGG + Intergenic
1004071188 6:12299482-12299504 AGAATCTATCTGAGTGAAGGGGG + Intergenic
1004709079 6:18153308-18153330 CAGATCCATCTGAATGTATGAGG + Intronic
1005246014 6:23885961-23885983 CAGATCTATATGATTGCTGTGGG + Intergenic
1005277458 6:24235175-24235197 CATATCTTTCAGATTGAGGGGGG + Intronic
1011855328 6:91682794-91682816 CTGATCTAACTAAGTGAAGGAGG - Intergenic
1012960168 6:105614174-105614196 TAGATTTTTCTGCTTGAAGGGGG - Intergenic
1012960426 6:105616200-105616222 TAGATTTTTCTGCTTGAAGGGGG - Intergenic
1014786233 6:125623179-125623201 CAGTTCTATGTGATTCAATGTGG + Intergenic
1017506050 6:155069551-155069573 CATCTGTATCTGTTTGAAGGTGG + Intronic
1021826601 7:24559044-24559066 CAGTTCTCTCTGATTGAATAGGG + Intergenic
1026383223 7:69820078-69820100 CAGTACCATCTGATTGAAGAAGG - Intronic
1026811414 7:73469380-73469402 TAGATCTATTTGAGTGAAGTAGG - Intronic
1028486496 7:91363951-91363973 CAGATCTATGGGAAAGAAGGAGG + Intergenic
1029064637 7:97837264-97837286 CAGCTGTAGATGATTGAAGGAGG + Intergenic
1032207316 7:129878930-129878952 CAGATCTATCTGATTGAAGGTGG - Intronic
1041203037 8:55470055-55470077 CAGCTCTATCTGATGTAATGGGG + Intronic
1044261865 8:90134446-90134468 CTGATCTATCTGACAGGAGGTGG + Intergenic
1047261038 8:123260191-123260213 AAGAGCTATCTGGTTGGAGGAGG + Intronic
1051828917 9:21254073-21254095 TAGATCTATATGAATGAATGAGG + Intergenic
1062456708 9:136643247-136643269 CAGAATTATCAGATTGAAGGTGG - Intergenic
1185949716 X:4419256-4419278 AAGATCTCTTTGAATGAAGGGGG - Intergenic
1187037309 X:15554492-15554514 CAGCTTTATTTGATTGAGGGTGG + Intronic
1188602398 X:31984512-31984534 AAGATCTATTTGATTGATAGTGG - Intronic
1189145813 X:38653724-38653746 TAGATTTACCTGCTTGAAGGAGG + Intronic