ID: 1032209762

View in Genome Browser
Species Human (GRCh38)
Location 7:129902630-129902652
Sequence CAAGCTCCTCCACCTTAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032209762_1032209763 -4 Left 1032209762 7:129902630-129902652 CCTATTTAAGGTGGAGGAGCTTG 0: 1
1: 0
2: 2
3: 9
4: 119
Right 1032209763 7:129902649-129902671 CTTGTTAGAAATGAACACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032209762 Original CRISPR CAAGCTCCTCCACCTTAAAT AGG (reversed) Intronic
904628104 1:31819814-31819836 CAAGCTCCACCCCCTCAACTTGG + Intergenic
906282791 1:44565685-44565707 CAAACCCCTCCAGCTAAAATGGG - Intronic
906962681 1:50427915-50427937 CTCGCTCCTCCACCTTCAGTTGG - Intergenic
911379958 1:97101146-97101168 CAAGCATCTCCACATCAAATTGG + Intronic
914976045 1:152363379-152363401 GAACCTCCACCACCTTAAATAGG - Intergenic
918175543 1:182041114-182041136 CAGGCTCCTCCCCCTTCAAATGG + Intergenic
918461585 1:184782497-184782519 CAAACTCCACAACCTTAATTTGG + Intergenic
918806214 1:189049152-189049174 CAAGTTTCTCCCCCTTTAATTGG + Intergenic
923512946 1:234668574-234668596 CAGGCTCCTCCCTCTTGAATGGG + Intergenic
1067139863 10:43648314-43648336 CAAGCTCCTAAACCTGAAACTGG - Intronic
1067369289 10:45667924-45667946 GAAGCTCGTCAACCTTATATTGG - Intronic
1070920777 10:80184425-80184447 CCAGCTCCTCCACTTTTGATGGG - Intronic
1072830013 10:98647553-98647575 CAAGCTTCTCCCCCTTCAGTAGG - Intronic
1074826913 10:117221250-117221272 CCAGCTCCACCACCTGAAACTGG - Intergenic
1078360787 11:10666040-10666062 CAAGGTCCTACTGCTTAAATGGG + Intronic
1079085371 11:17441088-17441110 CCACCTCCTCCAACTAAAATTGG - Intronic
1083731009 11:64652671-64652693 CCAGCTCCTCCATCTACAATGGG + Intronic
1085147257 11:74212552-74212574 CAAGCTGCTCCACCTGAGGTTGG - Intronic
1085201012 11:74702380-74702402 TAAGATCCACCACCTTAAAAAGG + Intronic
1085312263 11:75523866-75523888 CACGCTCCTCCACCTTCCAGGGG + Intronic
1085522900 11:77148460-77148482 CACTCTCCTCCACCTTCAAATGG + Intronic
1085775474 11:79362250-79362272 CAAGCCTCTGCACCTGAAATTGG - Intronic
1089593120 11:119557646-119557668 CTGCCTCCACCACCTTAAATAGG - Intergenic
1091346065 11:134855024-134855046 CAAGCACCTGCCCCTTGAATTGG - Intergenic
1094451433 12:30586611-30586633 CAATTTCCTCAACCTTAAAGTGG + Intergenic
1099244678 12:80180576-80180598 CAAACTGACCCACCTTAAATGGG - Intergenic
1099661373 12:85567913-85567935 CAAGCTCCTCCACCTCGAACAGG - Intergenic
1099808804 12:87554498-87554520 CAAGAGCCTCCACATTAGATTGG - Intergenic
1101521462 12:105486092-105486114 CAAATTCCTCATCCTTAAATAGG + Intergenic
1101593376 12:106141539-106141561 CATGCTCCGTCTCCTTAAATGGG + Intergenic
1102614507 12:114141598-114141620 CACCCTGCTCCACCTTAAATGGG - Intergenic
1103395650 12:120604865-120604887 CAAGCACCTCCACATTAAATAGG - Intergenic
1106042253 13:26104188-26104210 CAAGCTCTGCCTCCTTAAGTGGG + Intergenic
1110684612 13:78357592-78357614 AAAGCAACTCCATCTTAAATAGG + Intergenic
1113313592 13:109156180-109156202 CAAGCACTTCGACCTGAAATTGG - Intronic
1114536791 14:23428045-23428067 CAAAATCCTCCACCTTGAACCGG - Intronic
1115214191 14:30998221-30998243 CAAGCTCATCCAGCATAAACAGG + Intronic
1119616888 14:76104710-76104732 CAAGGTCCTTCACCTGAATTTGG + Intergenic
1120263274 14:82215981-82216003 AAAGCTCTTCCATCTTAAAAAGG - Intergenic
1121721866 14:96115004-96115026 CAAGCTCATCCACTAGAAATGGG - Intergenic
1121996835 14:98609135-98609157 CAGGTTCCTCCTCCTTAAAATGG - Intergenic
1122889961 14:104727668-104727690 CCAGCTCCTACCCCTCAAATGGG + Intronic
1128784027 15:70381583-70381605 CAGCCTCCTCCACCCTGAATAGG + Intergenic
1129878787 15:78993905-78993927 CAACTTCCTCCACCTTTTATAGG + Intronic
1131863203 15:96676850-96676872 CAATTTCCTCAACATTAAATGGG - Intergenic
1132115141 15:99130658-99130680 CGACCTCCTCCACTTTGAATGGG - Exonic
1135428745 16:22363684-22363706 TAAGCTCCTCCCCCTTAAATTGG - Intronic
1135823892 16:25709235-25709257 CAAGCTTCTCCACCTATACTTGG - Intronic
1135953710 16:26938435-26938457 CCAACTCCTCCAACTTAAATGGG + Intergenic
1137749886 16:50853151-50853173 CATCCTCCTCCTCCTTGAATTGG - Intergenic
1138147242 16:54623687-54623709 CAAGCTCCTCTATCTTTATTTGG - Intergenic
1139632946 16:68241484-68241506 CAAGCTCCCCTACCTGAACTAGG - Intergenic
1140904722 16:79400556-79400578 CAGGCTCCTCCACTCTAAAATGG + Intergenic
1141798324 16:86289590-86289612 CCAGCGCCTCCACTTTAAAAGGG - Intergenic
1143072684 17:4310469-4310491 CATGCTCCTCTACCTAAAGTAGG - Intronic
1150574773 17:66420700-66420722 CATGCTCCTCAACCTAGAATGGG - Intronic
1152235511 17:79136330-79136352 CAGGCTCCACCACCTTACATAGG - Intronic
1156663451 18:39376263-39376285 CAAGCTGCTGCTTCTTAAATTGG - Intergenic
1156866522 18:41894764-41894786 GAAGCTGCTCCATCTTCAATAGG + Intergenic
1156920779 18:42520226-42520248 CAGACTCCTCCACATTAAATAGG - Intergenic
1157237725 18:45980072-45980094 CAAGCTGCTGCACCTTTAAGAGG - Intergenic
1164977005 19:32581077-32581099 CAAGCTCGACCGCCTGAAATCGG + Exonic
926883560 2:17575476-17575498 CAACCTTCTCAACCTTATATAGG + Intronic
926897885 2:17714566-17714588 CAGGCCCCTCCCTCTTAAATTGG + Intronic
926972904 2:18484675-18484697 CCAGTTCCTCAACTTTAAATAGG - Intergenic
935139657 2:100341801-100341823 TGAGCTCCTCCACCTTAGATAGG + Intergenic
935262905 2:101370449-101370471 CAATCTCCTTCACCCTAAAATGG - Intronic
937634104 2:124136450-124136472 TAACCTAGTCCACCTTAAATGGG + Intronic
942314612 2:174685882-174685904 AGAGCAACTCCACCTTAAATAGG - Intergenic
947757443 2:232577571-232577593 CAATCTGCTCTACCTTAAAATGG - Intronic
1169264556 20:4160071-4160093 CGATCTCCTCCTCCATAAATAGG - Intronic
1170010849 20:11722124-11722146 CCAGCTCCCCTACCTTGAATTGG + Intergenic
1170037961 20:12010024-12010046 CATGCTACTCCACCTACAATGGG + Intergenic
1171199687 20:23231250-23231272 GAAGCAACTCCACCTTATATAGG + Intergenic
1171266371 20:23775222-23775244 AAAGCTCCTCCACCTTCTCTTGG - Intergenic
1176584814 21:8571715-8571737 GAAGCTACTCCACCTTACAGAGG + Intergenic
1177607313 21:23398274-23398296 CAAGCTTCTCCTCCTGAAAATGG + Intergenic
1180267625 22:10548617-10548639 GAAGCTACTCCACCTTACAGAGG + Intergenic
1181730606 22:24843591-24843613 CAACCTCCTCAACCTCAAAGTGG + Intronic
1181963721 22:26642058-26642080 CAACCTCCTCCTCCTTCACTGGG - Intergenic
1182892002 22:33826952-33826974 CAGCCTCCTCCACCTGAAAAGGG + Intronic
954350714 3:50041192-50041214 CATGCCCCTCAACCTTACATTGG + Intronic
959989509 3:112615556-112615578 AAAGCAACTCCATCTTAAATAGG + Intronic
963573787 3:147033182-147033204 CAAACTTCTACACCTAAAATTGG + Intergenic
963684949 3:148421605-148421627 CAAGAAACTCCCCCTTAAATTGG - Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
966430733 3:179829491-179829513 CCAGTTTCTCCACCTTAAAATGG + Intronic
967983918 3:195081445-195081467 CCAGCTCCGCCACCTTCCATCGG + Intronic
969419670 4:7084984-7085006 AAAGCAACTCCACCTTGAATAGG - Intergenic
971043166 4:22777535-22777557 CTAGCTCCTGCAATTTAAATGGG + Intergenic
971097140 4:23420083-23420105 CAAGAGGCTCCTCCTTAAATAGG + Intergenic
971292844 4:25360339-25360361 CAAGCACATCCAGCTCAAATGGG - Intronic
974887551 4:67839024-67839046 CCAGTTCCTCCACCTGACATTGG + Intronic
975648090 4:76565378-76565400 AAAGCTACTCCTTCTTAAATTGG + Intronic
977119328 4:93077220-93077242 CATGCTCCTCCATCTCAACTTGG - Intronic
981657143 4:147124675-147124697 CCAGCACCTTGACCTTAAATTGG - Intergenic
983498483 4:168472336-168472358 CAAGCTGCTCCAAGATAAATAGG + Intronic
989140951 5:38200736-38200758 CTAGCTCCTCCATCTTAGAAAGG - Intergenic
990370574 5:55114343-55114365 CATACTCCTCCACGTTACATGGG + Intronic
991568392 5:68029231-68029253 CAAGCTGCTCCCTCTTAAAGAGG - Intergenic
992865848 5:80956499-80956521 AAAGCAACTCCATCTTAAATAGG - Intergenic
995251130 5:109994476-109994498 AAAGCTCCTCTAGCTGAAATGGG - Intergenic
995863615 5:116666805-116666827 CAGGCTCTTCCACCAGAAATGGG - Intergenic
998921418 5:147072563-147072585 CAATTTCCTCCACCGTAAAATGG + Intronic
1002422217 5:179154610-179154632 CAAGCCCTTCCTCCTTCAATTGG + Intronic
1003280890 6:4690454-4690476 CAAGCCCCTCCACCAACAATGGG + Intergenic
1004210106 6:13631753-13631775 AAAGCCCCTCCACCTTCAACTGG + Intronic
1006600910 6:35225234-35225256 CCATCTCCTCCCCCTTAAAATGG - Intronic
1009418407 6:63440304-63440326 CAGGCTCCTCCACCTACAAACGG - Intergenic
1010091417 6:71987132-71987154 CAAGCTCCTCCACATTTTTTTGG + Intronic
1012218204 6:96614869-96614891 CAGCCTCCTCCACTTTAACTTGG - Intronic
1013235020 6:108190597-108190619 CAACCTTCCCAACCTTAAATGGG + Intergenic
1019822984 7:3259851-3259873 AAAGCAACTCCATCTTAAATAGG + Intergenic
1020659993 7:10970996-10971018 AAAGTTCCTCCACCTGAAAAAGG + Intergenic
1024189393 7:46990386-46990408 CACGCTCCTCCCTCATAAATGGG + Intergenic
1030334596 7:108311058-108311080 CAAGCGTTTCCACCTTAAAAGGG + Intronic
1030547640 7:110917577-110917599 CATGCTCCTCCAGCAAAAATAGG + Intronic
1030759178 7:113329804-113329826 CACGCTCCTCAACCTATAATGGG - Intergenic
1032209762 7:129902630-129902652 CAAGCTCCTCCACCTTAAATAGG - Intronic
1032707030 7:134430045-134430067 CAAGGTCATCCAGCTTAAATAGG + Intergenic
1040972085 8:53146319-53146341 CAAGCTACTTCACCTGAAATTGG + Intergenic
1047550592 8:125868521-125868543 CAATCCACTCCACCTTAAGTAGG - Intergenic
1057588119 9:96347671-96347693 CGAGCAACTCCATCTTAAATAGG + Intronic
1059559811 9:115323329-115323351 CATGGTCCTCAACCTTAACTAGG - Intronic
1061318856 9:129815175-129815197 CAAGCTCCTCCTCATTCACTGGG + Intronic
1189626776 X:42906057-42906079 CATGCTCCTGAACCATAAATGGG + Intergenic
1190455835 X:50627229-50627251 GAACCTCCTCCACCATTAATGGG - Intronic
1197167730 X:123396303-123396325 TATGCAGCTCCACCTTAAATGGG + Intronic
1197383016 X:125768636-125768658 CAATCTCCTCACCGTTAAATTGG - Intergenic
1198495866 X:137192508-137192530 CAGGCTTCTCCACCATGAATAGG - Intergenic
1199968980 X:152844679-152844701 GAAGCCCCTGCACCTTAGATGGG + Intronic