ID: 1032221220

View in Genome Browser
Species Human (GRCh38)
Location 7:129995695-129995717
Sequence GAAAATGAACACATTCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032221217_1032221220 -8 Left 1032221217 7:129995680-129995702 CCTTCCCAGGGAGATGAAAATGA No data
Right 1032221220 7:129995695-129995717 GAAAATGAACACATTCAGCCAGG No data
1032221213_1032221220 23 Left 1032221213 7:129995649-129995671 CCTGTGGCACATCTCAGAACTCA No data
Right 1032221220 7:129995695-129995717 GAAAATGAACACATTCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032221220 Original CRISPR GAAAATGAACACATTCAGCC AGG Intergenic
No off target data available for this crispr