ID: 1032221476 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:129997758-129997780 |
Sequence | TGTTTCCCCCAGGCTTGGAA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1032221476_1032221482 | 4 | Left | 1032221476 | 7:129997758-129997780 | CCATTCCAAGCCTGGGGGAAACA | No data | ||
Right | 1032221482 | 7:129997785-129997807 | GGAATGGTGAGCACACTAAGCGG | No data | ||||
1032221476_1032221483 | 14 | Left | 1032221476 | 7:129997758-129997780 | CCATTCCAAGCCTGGGGGAAACA | No data | ||
Right | 1032221483 | 7:129997795-129997817 | GCACACTAAGCGGTTTGTTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1032221476 | Original CRISPR | TGTTTCCCCCAGGCTTGGAA TGG (reversed) | Intergenic | ||