ID: 1032221477

View in Genome Browser
Species Human (GRCh38)
Location 7:129997763-129997785
Sequence CCGTGTGTTTCCCCCAGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032221477_1032221482 -1 Left 1032221477 7:129997763-129997785 CCAAGCCTGGGGGAAACACACGG No data
Right 1032221482 7:129997785-129997807 GGAATGGTGAGCACACTAAGCGG No data
1032221477_1032221483 9 Left 1032221477 7:129997763-129997785 CCAAGCCTGGGGGAAACACACGG No data
Right 1032221483 7:129997795-129997817 GCACACTAAGCGGTTTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032221477 Original CRISPR CCGTGTGTTTCCCCCAGGCT TGG (reversed) Intergenic
No off target data available for this crispr