ID: 1032221482

View in Genome Browser
Species Human (GRCh38)
Location 7:129997785-129997807
Sequence GGAATGGTGAGCACACTAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032221476_1032221482 4 Left 1032221476 7:129997758-129997780 CCATTCCAAGCCTGGGGGAAACA No data
Right 1032221482 7:129997785-129997807 GGAATGGTGAGCACACTAAGCGG No data
1032221480_1032221482 -6 Left 1032221480 7:129997768-129997790 CCTGGGGGAAACACACGGGAATG No data
Right 1032221482 7:129997785-129997807 GGAATGGTGAGCACACTAAGCGG No data
1032221477_1032221482 -1 Left 1032221477 7:129997763-129997785 CCAAGCCTGGGGGAAACACACGG No data
Right 1032221482 7:129997785-129997807 GGAATGGTGAGCACACTAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032221482 Original CRISPR GGAATGGTGAGCACACTAAG CGG Intergenic
No off target data available for this crispr