ID: 1032221484

View in Genome Browser
Species Human (GRCh38)
Location 7:129997818-129997840
Sequence AAGTATATACGTACACCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032221480_1032221484 27 Left 1032221480 7:129997768-129997790 CCTGGGGGAAACACACGGGAATG No data
Right 1032221484 7:129997818-129997840 AAGTATATACGTACACCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032221484 Original CRISPR AAGTATATACGTACACCAGC TGG Intergenic
No off target data available for this crispr