ID: 1032222574

View in Genome Browser
Species Human (GRCh38)
Location 7:130005891-130005913
Sequence CAGTGGAAGGGGAAAGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032222574_1032222581 10 Left 1032222574 7:130005891-130005913 CCAGCTGCTTTCCCCTTCCACTG No data
Right 1032222581 7:130005924-130005946 TCTGCCTTCTTCTTATCAAGAGG No data
1032222574_1032222582 13 Left 1032222574 7:130005891-130005913 CCAGCTGCTTTCCCCTTCCACTG No data
Right 1032222582 7:130005927-130005949 GCCTTCTTCTTATCAAGAGGAGG No data
1032222574_1032222584 30 Left 1032222574 7:130005891-130005913 CCAGCTGCTTTCCCCTTCCACTG No data
Right 1032222584 7:130005944-130005966 AGGAGGCCAGTCATGTCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032222574 Original CRISPR CAGTGGAAGGGGAAAGCAGC TGG (reversed) Intergenic
No off target data available for this crispr