ID: 1032225917

View in Genome Browser
Species Human (GRCh38)
Location 7:130031716-130031738
Sequence TGCCCAGCAAAGACCTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032225915_1032225917 20 Left 1032225915 7:130031673-130031695 CCTGGAATCTAGAAGGACATGTG 0: 1
1: 0
2: 1
3: 18
4: 186
Right 1032225917 7:130031716-130031738 TGCCCAGCAAAGACCTGAAAAGG No data
1032225914_1032225917 21 Left 1032225914 7:130031672-130031694 CCCTGGAATCTAGAAGGACATGT 0: 1
1: 0
2: 8
3: 44
4: 215
Right 1032225917 7:130031716-130031738 TGCCCAGCAAAGACCTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032225917 Original CRISPR TGCCCAGCAAAGACCTGAAA AGG Intronic
No off target data available for this crispr