ID: 1032229574

View in Genome Browser
Species Human (GRCh38)
Location 7:130063012-130063034
Sequence AAGTGTCCATAGGCTCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032229572_1032229574 19 Left 1032229572 7:130062970-130062992 CCTACACATCTTATTTTATGCGT No data
Right 1032229574 7:130063012-130063034 AAGTGTCCATAGGCTCCACCAGG No data
1032229571_1032229574 29 Left 1032229571 7:130062960-130062982 CCTTTGTAATCCTACACATCTTA No data
Right 1032229574 7:130063012-130063034 AAGTGTCCATAGGCTCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032229574 Original CRISPR AAGTGTCCATAGGCTCCACC AGG Intergenic
No off target data available for this crispr