ID: 1032239428

View in Genome Browser
Species Human (GRCh38)
Location 7:130149511-130149533
Sequence CCCGGCCGCCCCGGGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032239428_1032239436 -3 Left 1032239428 7:130149511-130149533 CCTGCTCCCCCGGGGCGGCCGGG No data
Right 1032239436 7:130149531-130149553 GGGCACATGAATATGGAGAGTGG No data
1032239428_1032239434 -10 Left 1032239428 7:130149511-130149533 CCTGCTCCCCCGGGGCGGCCGGG No data
Right 1032239434 7:130149524-130149546 GGCGGCCGGGCACATGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032239428 Original CRISPR CCCGGCCGCCCCGGGGGAGC AGG (reversed) Intergenic
No off target data available for this crispr