ID: 1032239522

View in Genome Browser
Species Human (GRCh38)
Location 7:130149927-130149949
Sequence GGTGCAGAAGAGGCAGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032239507_1032239522 29 Left 1032239507 7:130149875-130149897 CCTCATGTTCATCTAGTGAGGCG No data
Right 1032239522 7:130149927-130149949 GGTGCAGAAGAGGCAGCCGCAGG No data
1032239519_1032239522 -9 Left 1032239519 7:130149913-130149935 CCCAGGCAGGTGTGGGTGCAGAA No data
Right 1032239522 7:130149927-130149949 GGTGCAGAAGAGGCAGCCGCAGG No data
1032239520_1032239522 -10 Left 1032239520 7:130149914-130149936 CCAGGCAGGTGTGGGTGCAGAAG No data
Right 1032239522 7:130149927-130149949 GGTGCAGAAGAGGCAGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032239522 Original CRISPR GGTGCAGAAGAGGCAGCCGC AGG Intergenic
No off target data available for this crispr