ID: 1032240341

View in Genome Browser
Species Human (GRCh38)
Location 7:130154588-130154610
Sequence CAGGCTGCGCAGCTGGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032240341_1032240345 -9 Left 1032240341 7:130154588-130154610 CCAAGTGCCAGCTGCGCAGCCTG No data
Right 1032240345 7:130154602-130154624 CGCAGCCTGGCCCAGAGTCCGGG No data
1032240341_1032240357 25 Left 1032240341 7:130154588-130154610 CCAAGTGCCAGCTGCGCAGCCTG No data
Right 1032240357 7:130154636-130154658 CCGCAGTGCCTGCAGCTGCCTGG No data
1032240341_1032240347 -3 Left 1032240341 7:130154588-130154610 CCAAGTGCCAGCTGCGCAGCCTG No data
Right 1032240347 7:130154608-130154630 CTGGCCCAGAGTCCGGGCCCAGG No data
1032240341_1032240358 26 Left 1032240341 7:130154588-130154610 CCAAGTGCCAGCTGCGCAGCCTG No data
Right 1032240358 7:130154637-130154659 CGCAGTGCCTGCAGCTGCCTGGG No data
1032240341_1032240348 0 Left 1032240341 7:130154588-130154610 CCAAGTGCCAGCTGCGCAGCCTG No data
Right 1032240348 7:130154611-130154633 GCCCAGAGTCCGGGCCCAGGAGG No data
1032240341_1032240350 1 Left 1032240341 7:130154588-130154610 CCAAGTGCCAGCTGCGCAGCCTG No data
Right 1032240350 7:130154612-130154634 CCCAGAGTCCGGGCCCAGGAGGG No data
1032240341_1032240344 -10 Left 1032240341 7:130154588-130154610 CCAAGTGCCAGCTGCGCAGCCTG No data
Right 1032240344 7:130154601-130154623 GCGCAGCCTGGCCCAGAGTCCGG No data
1032240341_1032240359 27 Left 1032240341 7:130154588-130154610 CCAAGTGCCAGCTGCGCAGCCTG No data
Right 1032240359 7:130154638-130154660 GCAGTGCCTGCAGCTGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032240341 Original CRISPR CAGGCTGCGCAGCTGGCACT TGG (reversed) Intergenic
No off target data available for this crispr