ID: 1032246325

View in Genome Browser
Species Human (GRCh38)
Location 7:130216885-130216907
Sequence ATGAACTAGGTGAAGTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032246322_1032246325 20 Left 1032246322 7:130216842-130216864 CCACTTAAATGTATTCAGATGTT 0: 1
1: 0
2: 2
3: 36
4: 382
Right 1032246325 7:130216885-130216907 ATGAACTAGGTGAAGTTGGTTGG 0: 1
1: 0
2: 1
3: 22
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032246325 Original CRISPR ATGAACTAGGTGAAGTTGGT TGG Intergenic
901424194 1:9170894-9170916 ATGAATTAGGTGTACTTGGCCGG - Intergenic
902761309 1:18582612-18582634 ATTAACTAGGTGAAGAGGGAAGG + Intergenic
903056936 1:20642587-20642609 AAGAACTGGCTGAAATTGGTTGG - Intronic
905120793 1:35680242-35680264 AAGAAAAAGGTGAAGTTGGCCGG - Intergenic
906559816 1:46748261-46748283 ATGAACTTGGAGAAGTAGGATGG - Intergenic
907075738 1:51576431-51576453 ATGAATAAGGTGAAGTTTTTAGG - Intergenic
907895872 1:58690823-58690845 ATGTAATAGGTAAACTTGGTTGG + Intronic
907965597 1:59325511-59325533 GTGATCTGGGTGAAGATGGTGGG - Intronic
908883358 1:68758794-68758816 ATAAACTGGGTGCTGTTGGTGGG + Intergenic
909612460 1:77567150-77567172 ATAAACTTGGTGGTGTTGGTGGG - Intronic
910297481 1:85664609-85664631 AGGAACTAGGTGAAGGTGGAGGG + Intronic
911270028 1:95790070-95790092 ATGAAGTAGGTGAAGGGGATGGG + Intergenic
911546305 1:99221859-99221881 ATGAAGCAGGTTAAGTGGGTAGG + Intergenic
915447881 1:155984501-155984523 CTGATCTAGGTGAAGCGGGTGGG - Intronic
915668050 1:157462626-157462648 AGGAACAAAATGAAGTTGGTTGG - Intergenic
915767615 1:158380602-158380624 GTCAACTAGGTCAAGTTGGTTGG - Intergenic
915806255 1:158855744-158855766 ACCAATTAGGTGAAGTTGGCTGG + Intergenic
917163730 1:172087623-172087645 ATGAACTTGGTAAAGATGGATGG - Intronic
917475097 1:175362598-175362620 AAGATCTGGGTGAAGTTGTTCGG - Intronic
918498496 1:185166592-185166614 ATGAACTAGTAGAACTTGCTGGG - Exonic
919393749 1:197019726-197019748 ATGTACTTGCTGAAGCTGGTGGG + Intergenic
920285705 1:204877825-204877847 TTGAACCAGGAGAAGTTGCTAGG - Intronic
922572757 1:226643548-226643570 AGCAACTTGGAGAAGTTGGTGGG - Intronic
1063036281 10:2289633-2289655 AAGAACAAGGTCAACTTGGTGGG + Intergenic
1063306411 10:4905957-4905979 ATTAATTAGGTGTAGTTGGTTGG + Intergenic
1063965243 10:11341332-11341354 CTGAACAAGGTGAACTAGGTAGG - Intergenic
1064308642 10:14191017-14191039 AAGAACTGGCTAAAGTTGGTTGG - Intronic
1064557238 10:16559591-16559613 ATAAACTTGGTGCTGTTGGTGGG - Intergenic
1066258018 10:33700295-33700317 ATCATCTAGGTCAAGTTGGTTGG + Intergenic
1066482392 10:35809516-35809538 ATGAGCTAGATGCAGGTGGTGGG - Intergenic
1067746409 10:48939653-48939675 ATGATCTATGTGAATTTTGTTGG - Intronic
1067967846 10:50933993-50934015 ATTAACTAGGGGAAATCGGTGGG - Intergenic
1068887145 10:62109383-62109405 ATGAAGCAGGTGTTGTTGGTTGG + Intergenic
1070804315 10:79261873-79261895 ATGAACTATGTGATCTTGGCAGG - Intronic
1073131421 10:101191386-101191408 ATGAGGTAGGTGATGTTGGCGGG - Intergenic
1078891844 11:15564799-15564821 ATGAACAAAGTGAAGTTGCTGGG + Intergenic
1080133502 11:28825151-28825173 ATGACCTAGCTGAATTTGTTAGG - Intergenic
1086724030 11:90159654-90159676 AAAAACTAGGTGAAGGTGCTGGG + Intronic
1086743111 11:90391985-90392007 ATGAACTCGGTGCTGCTGGTGGG + Intergenic
1087218686 11:95522353-95522375 ACGTGATAGGTGAAGTTGGTGGG - Intergenic
1089360267 11:117881124-117881146 ATGAATGTGGAGAAGTTGGTTGG - Intergenic
1090146930 11:124334813-124334835 ACAAAATAGCTGAAGTTGGTTGG - Intergenic
1093122369 12:15287141-15287163 GTCAAATAGGTCAAGTTGGTTGG - Intronic
1093645647 12:21582960-21582982 AGGAACATAGTGAAGTTGGTTGG + Intronic
1094117009 12:26927091-26927113 ATGAAGTGGGTGAGGTTGGAAGG - Intronic
1094139186 12:27163194-27163216 GTCAGCTTGGTGAAGTTGGTAGG - Intergenic
1094265554 12:28555282-28555304 ATGACATAGGTGAATTTGATAGG + Intronic
1097607109 12:61768982-61769004 ATGAACTCTGTGCTGTTGGTGGG + Intronic
1098286623 12:68913588-68913610 ATCAACTAGATGTAGTTGATGGG + Intronic
1098478533 12:70934946-70934968 CTAAACTAGCTGAAATTGGTTGG + Intergenic
1099068847 12:78019620-78019642 ATCAACTGGATGAAGTTGGGAGG + Intronic
1099452949 12:82829813-82829835 GTCAACTAGGTGAAGGTGGGTGG + Intronic
1101701058 12:107174399-107174421 GTGAACCACGTGAAATTGGTTGG - Intergenic
1102391888 12:112555982-112556004 AGGAACTGGCTGAACTTGGTTGG + Intergenic
1102404091 12:112657778-112657800 ATGAAATAGGGGAAGTGGGTAGG + Intronic
1103430361 12:120879550-120879572 ATGAGCTATGAGAAGTTGGGCGG - Intronic
1104271325 12:127284973-127284995 AAGAACTGGCTGAAATTGGTTGG - Intergenic
1106202294 13:27549544-27549566 ATGAAATAGCTGAAAGTGGTTGG - Intronic
1106875372 13:34066335-34066357 AAGAACTGGGTGAAATTGGTTGG + Intergenic
1107344053 13:39440219-39440241 AAGGACTGGGTGAAGGTGGTGGG + Intronic
1107735474 13:43394624-43394646 ATGAACTTGGTGTGCTTGGTGGG - Intronic
1107851588 13:44577169-44577191 AGGAACGAGGTGGGGTTGGTCGG + Intergenic
1108135875 13:47358773-47358795 ATCAACAAGGATAAGTTGGTAGG - Intergenic
1109812542 13:67533115-67533137 AACAAATAGATGAAGTTGGTTGG - Intergenic
1110159880 13:72363209-72363231 ATGAACAAGGTAACTTTGGTCGG - Intergenic
1111052053 13:82897465-82897487 ATGAATAAGATCAAGTTGGTTGG + Intergenic
1111576129 13:90155752-90155774 ATGAACATAATGAAGTTGGTTGG - Intergenic
1112678411 13:101732198-101732220 AGTAACTAAGTGGAGTTGGTGGG - Intronic
1113225536 13:108155329-108155351 AGCTACTAGGTGAAGTAGGTGGG - Intergenic
1113354391 13:109564697-109564719 GTCAACTAGGTCAAATTGGTGGG + Intergenic
1114458717 14:22873391-22873413 ATGAGCCAGGTGCAGTTGGCAGG - Exonic
1115201415 14:30858325-30858347 ATAAACTGGGAGAAGTAGGTAGG - Intergenic
1118989885 14:70788382-70788404 ATCATCTAGGTGAAGTTCTTAGG - Intronic
1122644495 14:103184651-103184673 CAGAACTAGGTGAACTTGGCCGG + Intergenic
1125072108 15:35567460-35567482 AGAAAGTAGCTGAAGTTGGTAGG + Intergenic
1126928436 15:53618793-53618815 ATTAACTTTGTGAAGTTGTTGGG + Intronic
1127329389 15:57923718-57923740 ATGAACGATGTGAAGGTGGTGGG - Intergenic
1127681978 15:61306275-61306297 GTGAGCTAGGTGAAGAGGGTGGG + Intergenic
1133638589 16:7695280-7695302 ATGAGCAAGGTGAACTTGCTGGG - Intronic
1133868353 16:9665009-9665031 ATGAACTAGGTGAAGAAAGAAGG - Intergenic
1134233978 16:12451297-12451319 ATAAACTTGGTGGAGCTGGTGGG - Intronic
1134386149 16:13774458-13774480 GTCAACTAGGTCAAGTTGGTTGG - Intergenic
1135960899 16:26993704-26993726 ATCAACTATGTGACCTTGGTCGG - Intergenic
1137233485 16:46591641-46591663 GTCAACTAGATCAAGTTGGTTGG - Intronic
1144681008 17:17194470-17194492 ATGAAATGGGTGAAATTTGTGGG + Intronic
1150291388 17:63984424-63984446 ATGAGCTGGGAGAAGTTAGTGGG - Intergenic
1150664253 17:67116833-67116855 GTTAATTAGGTCAAGTTGGTTGG - Intronic
1150686543 17:67325688-67325710 AAGAAATAAATGAAGTTGGTCGG - Intergenic
1154247614 18:12713664-12713686 AAGAACTGGCTGAAATTGGTTGG - Intronic
1154505808 18:15039876-15039898 AGGAACAAAATGAAGTTGGTTGG + Intergenic
1155039322 18:22051774-22051796 ATGAAGTAGGTGAAGTTAGGAGG - Intergenic
1157005849 18:43583320-43583342 ATAAATTAAGTGAAGTTGATTGG - Intergenic
1157007385 18:43600155-43600177 ATCAATTAGGTCAGGTTGGTTGG - Intergenic
1159503092 18:69298837-69298859 ATGATGTTGGTGATGTTGGTGGG - Intergenic
1160213350 18:76903157-76903179 ATGAGCTAGGTGAAATTGGTTGG + Intronic
1163950187 19:20576878-20576900 ATAAACTTGGTGCTGTTGGTGGG - Intronic
1166290828 19:41862343-41862365 ATGAACTTGCTGAGGTGGGTCGG + Intronic
928683540 2:33726703-33726725 AGGAAATAGGAGAAGATGGTCGG + Intergenic
929283198 2:40105843-40105865 AGGAACTAGGCAAAGTAGGTGGG - Intronic
931592856 2:63904687-63904709 ATCAACTAAGTGGTGTTGGTTGG - Intronic
931660028 2:64551551-64551573 ATGAATTTGGGGAATTTGGTGGG + Exonic
933158640 2:79000768-79000790 ATGACTTAGGTGAGGTTGTTGGG - Intergenic
936633940 2:114234401-114234423 ATTAACTTGGTGCTGTTGGTGGG - Intergenic
939007262 2:136803965-136803987 ATGAACTAAGTAAAGTAGATGGG - Intronic
939566386 2:143790775-143790797 CTGAGCTAGGTGAAGCTGGGGGG + Intergenic
939640029 2:144629111-144629133 ATAAACAAGGAGAAGTTGTTCGG - Intergenic
941352458 2:164453556-164453578 ATTAACTAGTTTAAGTTAGTTGG - Intergenic
942585367 2:177469974-177469996 ATGAACAAGATGAAGTTGATAGG + Intronic
943789516 2:191916683-191916705 AGGAATGAGTTGAAGTTGGTTGG + Intergenic
945336367 2:208597444-208597466 CTGAACTGGATGAAGTGGGTTGG + Intronic
945656287 2:212628012-212628034 ATGACCTAGGGGAAGTAGGAAGG + Intergenic
946169713 2:217887602-217887624 AAGAACTAGGGGATGTTGGCTGG - Intronic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
948687560 2:239678405-239678427 ATGAACTAAGTTAATTTGTTAGG - Intergenic
1169234879 20:3922814-3922836 ATGAAACAGGTGAAGTTGTGAGG - Intronic
1169872238 20:10260191-10260213 TTAAAGTAGGTGAAGTTCGTAGG + Intronic
1171725926 20:28620817-28620839 AGGAACTAGGTGAAGAAGGGAGG - Intergenic
1171752204 20:29062563-29062585 AGGAACTAGGTGAAGAAGGGAGG + Intergenic
1172416709 20:34775035-34775057 ATGAACTAGGGGAAGGGGGTTGG + Intronic
1172650043 20:36496388-36496410 ATGTACTAGGTGAAGTGCGTGGG - Intronic
1172657879 20:36548085-36548107 AGGAACATGGTGAAGTTGATGGG - Exonic
1173271618 20:41541614-41541636 GTGAGATAAGTGAAGTTGGTGGG + Intronic
1173552653 20:43943610-43943632 ATGACCTATGTGAAGTAGGGAGG + Intronic
1174955986 20:55099254-55099276 ATTAAGGAGGAGAAGTTGGTAGG - Intergenic
1177991449 21:28040158-28040180 AGGAACAAAATGAAGTTGGTTGG - Intergenic
1180598213 22:16993716-16993738 ATGAACTAGGTAAATATGGTAGG - Intronic
1182804777 22:33060150-33060172 ATGTACTAAGTGAGGTTGGCAGG + Intergenic
949615698 3:5751707-5751729 GTAAACTAGGTGAAGATGGGAGG - Intergenic
951303521 3:21028293-21028315 ATGAAGTTGGTGAAGTAGGCAGG - Intergenic
952332221 3:32374636-32374658 ATTAACCAGGTGTGGTTGGTTGG - Intergenic
953113166 3:39963515-39963537 ATGAAATAGGTGACTTTGTTTGG + Intronic
956795884 3:72718287-72718309 AAGAACTAACTGAAGTTGGATGG - Intergenic
958775974 3:98483323-98483345 ATAAACTAGGTGCTATTGGTGGG - Intergenic
961263183 3:125618933-125618955 ATGAAGCAGGTGAAGAAGGTGGG + Intergenic
963014566 3:140809658-140809680 ATAAACTTGGTGCTGTTGGTGGG - Intergenic
963114669 3:141716713-141716735 GTCAATTAGGTCAAGTTGGTTGG + Intergenic
963441624 3:145346933-145346955 ATGAACAAGGTTAATTTGGAAGG + Intergenic
966483484 3:180440562-180440584 ATCAATTAGGTGAAGTTGATAGG - Intergenic
966755761 3:183369939-183369961 ATGAAGTTGGAGAAGTTAGTGGG - Intronic
967329472 3:188276299-188276321 ATGAAGTAGATGAAGGTTGTTGG + Intronic
968243144 3:197111288-197111310 GTGAACTAGGTTGAGTTGGTTGG + Intronic
969901523 4:10354795-10354817 ATAAACTTGGTGCTGTTGGTGGG - Intergenic
972622592 4:40762966-40762988 ATGAACTGGGGGAAGGTGGAGGG - Intronic
975060968 4:69998824-69998846 ATGAACTAGGTGCACTTGAGTGG + Intronic
975145376 4:70961744-70961766 ATGAAGTAGGTGAATAGGGTTGG + Intronic
975328933 4:73091702-73091724 ATGAACTGGTTGTAGTTGTTGGG + Exonic
977204259 4:94152283-94152305 AGGAACATAGTGAAGTTGGTTGG + Intergenic
979160067 4:117448507-117448529 ATAAACTCGGTGCAGTTGGGGGG - Intergenic
980119638 4:128714413-128714435 TAGAATTAGATGAAGTTGGTCGG - Intergenic
982299541 4:153865133-153865155 ATAAACTTGGTGCTGTTGGTGGG - Intergenic
985434625 4:189916978-189917000 AGGAACTAGGTGAAGAAGGGAGG + Intergenic
986745724 5:10742996-10743018 ATGAACTTGGTGCTGTTGGATGG - Intronic
987563540 5:19555405-19555427 ATAAACTTGGTGATGTTGGGTGG + Intronic
990521179 5:56582840-56582862 TTGAACAAGTTGAAGTTGGTAGG - Intronic
992802481 5:80306091-80306113 ATCAACCAGGTGAGGGTGGTAGG + Intergenic
992879411 5:81091341-81091363 ATGAAGGAGGTGAGGTGGGTGGG - Intronic
995254266 5:110028573-110028595 GTGAACTAGGTGAGGTCAGTGGG - Intergenic
996080775 5:119255835-119255857 ACCAACTAGGTGCTGTTGGTTGG + Intergenic
996815489 5:127569244-127569266 ATCAACTAGTTGACCTTGGTTGG + Intergenic
998596649 5:143537245-143537267 GTGAACTAGTTGAACTTGTTTGG + Intergenic
999307555 5:150530011-150530033 ATGAACTAGGTGACTTGGGCAGG + Intronic
1000145401 5:158448785-158448807 ATGAACAAGGAGAGGGTGGTTGG - Intergenic
1001115639 5:168937098-168937120 CTCAACCAGGTGAAGTTGGGGGG + Intronic
1003158967 6:3619179-3619201 CTGAACTAGGTGGAGATGTTAGG + Intergenic
1003947476 6:11088682-11088704 ATGAAGTAGGTGTAGGTGTTTGG + Intergenic
1007296589 6:40826972-40826994 TTGAACTGGGTGAAGATGCTGGG - Intergenic
1009715448 6:67387293-67387315 ATGACCCAGAAGAAGTTGGTGGG - Intergenic
1010167081 6:72928333-72928355 AGGAACTATGTGCAGTTGGAAGG + Intronic
1012087514 6:94849087-94849109 ATGTATTAGATGCAGTTGGTAGG + Intergenic
1012869797 6:104659311-104659333 ATGAACTTGGTGCTGTTCGTAGG + Intergenic
1014950256 6:127545942-127545964 AGGAACTATTTCAAGTTGGTTGG - Intronic
1015146336 6:129991601-129991623 ATGTACTTGGAGAAGGTGGTAGG - Intergenic
1018504747 6:164453141-164453163 ATAAACTACACGAAGTTGGTAGG + Intergenic
1024803045 7:53102968-53102990 ATTATCTAGGTGTGGTTGGTGGG + Intergenic
1027468139 7:78540432-78540454 ATAAACTTGGTGCTGTTGGTGGG - Intronic
1030713431 7:112781254-112781276 ATCAGCTAGATTAAGTTGGTTGG - Intronic
1031686548 7:124737028-124737050 ATGAATTAGGTGAATTAGGATGG - Intergenic
1032246325 7:130216885-130216907 ATGAACTAGGTGAAGTTGGTTGG + Intergenic
1032923796 7:136578710-136578732 AAGAACAAAATGAAGTTGGTTGG - Intergenic
1034588033 7:152113541-152113563 AAGTACTAGGTGAAGGGGGTGGG - Intronic
1038084362 8:24177153-24177175 ATGAAATAGGTCACGCTGGTTGG + Intergenic
1038490226 8:27965399-27965421 ATGAAGCAGGTGGAGTTGGTGGG - Intronic
1039586849 8:38714073-38714095 AAAATCTAGGTGAAGTTGGCTGG + Intergenic
1043534422 8:81186622-81186644 AAGAGATAGGTGAAGTTGGTGGG - Intergenic
1048170832 8:132104683-132104705 ATGAAGGAGGTGGAGGTGGTAGG + Intronic
1048714783 8:137256282-137256304 ATGAATTAGGTGGAGGTGGATGG + Intergenic
1049660613 8:143818206-143818228 ATGAACTCGGTGATGCTGGGGGG - Exonic
1050697839 9:8298837-8298859 ATGTACCAGTAGAAGTTGGTTGG - Intergenic
1051697216 9:19781368-19781390 ATGAAGTAGGGGAAGGTGGAAGG + Intronic
1053723685 9:40975051-40975073 AGGAACTAGGTGAAGAAGGGAGG + Intergenic
1054342275 9:63876948-63876970 AGGAACTAGGTGAAGAAGGGAGG - Intergenic
1054841195 9:69742271-69742293 ATGAATTATGTTAAGTGGGTTGG - Intronic
1055487678 9:76773093-76773115 ATAAAGTAGGGGAAGCTGGTAGG - Intronic
1055505356 9:76942541-76942563 ATGAAGGAGCTGAAGTTGCTTGG - Intergenic
1203451474 Un_GL000219v1:120947-120969 AGGAACTAGGTGAAGAAGGGAGG - Intergenic
1189305313 X:39982468-39982490 AAGAACTAGGTTAAGTTTGAAGG + Intergenic
1189888767 X:45577278-45577300 AGGGACCAGCTGAAGTTGGTGGG + Intergenic
1190615906 X:52231184-52231206 ATCAATTAGGTCGAGTTGGTTGG - Intergenic
1192895729 X:75441025-75441047 ATAAACTAGGTGCTGTTGGTGGG - Intronic
1192945068 X:75957515-75957537 ATGAACTCGATGCTGTTGGTAGG - Intergenic
1193315056 X:80055385-80055407 ATAAACTCGGTGCTGTTGGTGGG - Intergenic
1193826729 X:86235427-86235449 ATGACCTAGGTGAAGATGGAAGG - Intronic
1195423545 X:104702096-104702118 ATGCATTAGGTGAAGTTAATTGG - Intronic
1195773153 X:108373668-108373690 ATGAACAAGATGAAGTGTGTAGG - Intronic
1196104355 X:111880519-111880541 ATGGACTAACTGAAGTTTGTAGG - Intronic
1196597609 X:117563559-117563581 AAGGACTAGGAGAAGTTGGAAGG - Intergenic
1197646608 X:129024653-129024675 ATAAATTAGGTTAAGTTGGTTGG - Intergenic
1199019492 X:142860505-142860527 ATGAAATAGGTGAAGGTTCTTGG + Intergenic
1200640242 Y:5709120-5709142 ATGAATTGGGTGGGGTTGGTTGG - Intronic
1201400974 Y:13603492-13603514 ATGAATATAGTGAAGTTGGTTGG - Intergenic