ID: 1032246468

View in Genome Browser
Species Human (GRCh38)
Location 7:130217876-130217898
Sequence ATCCAGGCACAGTTGGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032246462_1032246468 11 Left 1032246462 7:130217842-130217864 CCAAACAGAGAGTCTTTGTCACA No data
Right 1032246468 7:130217876-130217898 ATCCAGGCACAGTTGGGGCTAGG No data
1032246461_1032246468 27 Left 1032246461 7:130217826-130217848 CCTGACTAAAGTTTGGCCAAACA No data
Right 1032246468 7:130217876-130217898 ATCCAGGCACAGTTGGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032246468 Original CRISPR ATCCAGGCACAGTTGGGGCT AGG Intergenic
No off target data available for this crispr