ID: 1032248878

View in Genome Browser
Species Human (GRCh38)
Location 7:130235786-130235808
Sequence GTTTATTAAATATTAACTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032248878_1032248882 21 Left 1032248878 7:130235786-130235808 CCATGAGTTAATATTTAATAAAC No data
Right 1032248882 7:130235830-130235852 TCCTATTAGTTCTGTCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032248878 Original CRISPR GTTTATTAAATATTAACTCA TGG (reversed) Intergenic
No off target data available for this crispr