ID: 1032252728

View in Genome Browser
Species Human (GRCh38)
Location 7:130271895-130271917
Sequence ATGGAGTAGCAGATGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 337}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032252728_1032252735 -3 Left 1032252728 7:130271895-130271917 CCTTCCTGCATCTGCTACTCCAT 0: 1
1: 0
2: 2
3: 35
4: 337
Right 1032252735 7:130271915-130271937 CATGCTGCTGTGGGGATCCTGGG 0: 1
1: 0
2: 2
3: 20
4: 260
1032252728_1032252737 20 Left 1032252728 7:130271895-130271917 CCTTCCTGCATCTGCTACTCCAT 0: 1
1: 0
2: 2
3: 35
4: 337
Right 1032252737 7:130271938-130271960 CAGTGCTGCATTTACTTCTGTGG 0: 1
1: 0
2: 1
3: 18
4: 312
1032252728_1032252734 -4 Left 1032252728 7:130271895-130271917 CCTTCCTGCATCTGCTACTCCAT 0: 1
1: 0
2: 2
3: 35
4: 337
Right 1032252734 7:130271914-130271936 CCATGCTGCTGTGGGGATCCTGG 0: 1
1: 0
2: 1
3: 32
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032252728 Original CRISPR ATGGAGTAGCAGATGCAGGA AGG (reversed) Intronic
900007579 1:73168-73190 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
900890964 1:5449393-5449415 CTGGCTTTGCAGATGCAGGAAGG + Intergenic
900918223 1:5653078-5653100 AGGGAGGGGCAGGTGCAGGAGGG + Intergenic
900967259 1:5967312-5967334 CTGGAGAAGCGGGTGCAGGAGGG + Exonic
902654826 1:17859961-17859983 AGGGAGGAGCAGGTGGAGGAAGG + Intergenic
904108796 1:28108553-28108575 ATGGAATGGCAGAGGCAGGCAGG - Intergenic
904576635 1:31509243-31509265 ATGGTGTAGCAGATGGTGGCAGG - Intergenic
904654036 1:32029073-32029095 ATGGAGAGGCAGATGAAGGGAGG - Intronic
904767695 1:32862976-32862998 CTGGAGTAGAAGCTGCTGGAAGG - Exonic
905476125 1:38229408-38229430 ATGGAGTAGGAAAGGCAGGCAGG + Intergenic
906114966 1:43350338-43350360 AAGAAGCAGCAGATGAAGGATGG - Intronic
906706387 1:47898092-47898114 ATGAATGAGCAGATGAAGGAAGG + Intronic
907684840 1:56600508-56600530 CTGGAGTAGCAGCAGCAGGAAGG + Intronic
908858780 1:68459794-68459816 ATGGGGTAGAAGAAGCAGGGTGG + Intergenic
909344887 1:74573169-74573191 AGGGAGCAGCAGAAGCAGAAGGG - Exonic
909546792 1:76857282-76857304 AAGGGGTAGCAGCTGCAGGAAGG - Intergenic
912272582 1:108226304-108226326 ATGGAGTTGGGGATGCAGCAAGG + Intronic
912295637 1:108468018-108468040 ATGGAGTTGGGGATGCAGCAAGG - Intronic
914196204 1:145449295-145449317 ATAGACCAGCAGATGCAGGAAGG - Intergenic
914314626 1:146498540-146498562 ATGGAGTTTGGGATGCAGGAAGG + Intergenic
914499722 1:148234848-148234870 ATGGAGTTTGGGATGCAGGAAGG - Intergenic
914925986 1:151888125-151888147 AGGGAGTGGGAGAAGCAGGACGG - Intronic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
916330928 1:163615911-163615933 ACTGTGCAGCAGATGCAGGATGG + Intergenic
916635425 1:166662749-166662771 ATGGAGTAGAAGATGGAAGAAGG - Intergenic
919940738 1:202284279-202284301 AAGGAGTTGTGGATGCAGGATGG - Intronic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
922027710 1:221767137-221767159 CAGGAGTAGGAGAGGCAGGAGGG - Intergenic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
922755349 1:228093554-228093576 ATGGAATGGCAGAACCAGGATGG - Intronic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
924665556 1:246067918-246067940 ACTGAGTAGCTGCTGCAGGAAGG + Intronic
1063477686 10:6343217-6343239 ATGGAGTGCCAGGTGTAGGAGGG + Intergenic
1064110957 10:12538613-12538635 ATGGAGTGCCAGTTCCAGGAAGG + Intronic
1064265425 10:13821571-13821593 GTGAAGTAGCAGCTGCAGGCGGG - Intronic
1065971841 10:30811965-30811987 ATGTAGTAACTGATGCAGGCTGG - Intergenic
1066055060 10:31673216-31673238 AGGGAGTAGCAGATGGGAGAAGG + Intergenic
1068730088 10:60348173-60348195 ATGAAATAGCAGAGGCAAGATGG - Intronic
1069836463 10:71311620-71311642 AGGAAGAAGCAAATGCAGGAAGG + Intergenic
1070210774 10:74318271-74318293 ATGGAGGTGGAGATGGAGGAAGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1072731003 10:97846902-97846924 ATGGTCTACCAGATGCTGGAGGG + Intergenic
1073542132 10:104323112-104323134 GTGGAGTAGAAGAGGCAGGCTGG + Intronic
1073829427 10:107364529-107364551 CTGGAGTAGCAGAGGCAAGGTGG + Intergenic
1074532185 10:114305411-114305433 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532207 10:114305495-114305517 CTGCAGGAGGAGATGCAGGAGGG + Intronic
1074532235 10:114305603-114305625 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532241 10:114305639-114305661 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532268 10:114305726-114305748 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532366 10:114306085-114306107 AAGGAGATGCAGATGCAGGAAGG + Intronic
1074532403 10:114306211-114306233 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074813863 10:117130510-117130532 AAGGAGAAACAGCTGCAGGAGGG - Intronic
1075044123 10:119132761-119132783 ATGGACAAGCAGGTGCAGGCTGG + Intronic
1076939261 10:133590750-133590772 GTGGAGCAGAAGATGCAGGAAGG - Intergenic
1077392572 11:2306913-2306935 AGGGAGGAGGAGATGGAGGAGGG + Intronic
1077608584 11:3628818-3628840 ATGCAGGGGCAGAGGCAGGATGG + Intergenic
1078530167 11:12130956-12130978 CTGGAGGAGCAGAGGCCGGAGGG + Intronic
1079166790 11:18051616-18051638 AGAGAGAAGCATATGCAGGAAGG - Intergenic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1081465804 11:43315728-43315750 AAGGAGTAGCAGAGGCAGAGTGG - Intronic
1081784036 11:45733755-45733777 ATGGAGCTGGAGATGCAGGCAGG - Intergenic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1082857692 11:57823628-57823650 ATGGAGAATCAGATGCAAGAAGG + Intergenic
1083011111 11:59400445-59400467 AAAGAGTAGCAGATGAAGAATGG + Intergenic
1083489201 11:63002648-63002670 GTGGAGTAGGAGAGGGAGGAAGG - Intronic
1083543023 11:63527897-63527919 ATGGGGTAAGACATGCAGGAAGG - Intergenic
1083752908 11:64771379-64771401 ATTTAGTAGCAGCTGCAAGAAGG + Intronic
1084712711 11:70853811-70853833 ATGGAGTGGAAGAGGCAGGGAGG - Intronic
1085296318 11:75433706-75433728 ATTCAGTAGCAGGGGCAGGAGGG + Intergenic
1088011896 11:105013790-105013812 ATGGAGGAGCAAATGAAGGATGG - Intronic
1088589994 11:111395157-111395179 ATGGAGGAGCTGTTGCTGGATGG - Intronic
1088747997 11:112820575-112820597 GAGAAGCAGCAGATGCAGGAAGG + Intergenic
1088875740 11:113934886-113934908 AAGGAGTAGCACATGCAAGGTGG + Intronic
1089126705 11:116181290-116181312 ATGGAGTCACACAGGCAGGAAGG + Intergenic
1089407659 11:118211829-118211851 TGGGATTAGCAGATGCAGCATGG - Intronic
1090639710 11:128719883-128719905 AAGTAGTAGCACCTGCAGGATGG - Intronic
1091589946 12:1836984-1837006 ATGGCCTGGCAGATCCAGGATGG + Intronic
1091779269 12:3203821-3203843 GTGGAGGAGCAGGTGCAGGAGGG + Intronic
1094688136 12:32740951-32740973 ATGAAGGAGAAGATGCAGTAGGG - Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096514033 12:52146654-52146676 ATGGAGTATCAGCTGAAGCAGGG + Intergenic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1097544447 12:60981540-60981562 CAGGAGTAGCATATGCAGGAAGG + Intergenic
1097578862 12:61428794-61428816 TTGCAGTAGAAGATGAAGGAGGG - Intergenic
1098671407 12:73235203-73235225 TGGGATTACCAGATGCAGGAGGG - Intergenic
1098848387 12:75565851-75565873 ATGGAGTAACAGATGGGGGAAGG + Intergenic
1100371364 12:93971825-93971847 ATGGAGTGGCAGATGAGAGATGG + Intergenic
1100855504 12:98753935-98753957 ATGGAGAGGAAGATGCAGGATGG + Intronic
1101252474 12:102949765-102949787 TTGGGGTGGGAGATGCAGGAAGG + Intronic
1102651693 12:114447085-114447107 AGGGAGTTGTCGATGCAGGATGG - Intergenic
1102966935 12:117135151-117135173 ATTCAGGAGCAGAGGCAGGAGGG - Intergenic
1104065048 12:125299286-125299308 AGGGAAGAGCAGATCCAGGAGGG - Intronic
1104531379 12:129574192-129574214 ATGGATTAATAGATGCAAGAAGG + Intronic
1104886408 12:132111819-132111841 AGGGAGATGCAGATGCAGGTGGG + Intronic
1105239204 13:18595478-18595500 ATGGAGTGGCGGCTGCAGGGAGG + Intergenic
1111113456 13:83745819-83745841 GTGCAGTAGCTGATGCAGGCTGG - Intergenic
1111616087 13:90663424-90663446 ATGAAGTAACCGAAGCAGGAAGG - Intergenic
1112872793 13:103995385-103995407 ATGGGGTAGGAGAAGCAGGGAGG - Intergenic
1114404182 14:22439695-22439717 AGGGAGTAGCAGTGGCATGAAGG + Intergenic
1114604881 14:23988617-23988639 GTGGACAAGCAGATGCAGAAGGG + Intronic
1115059138 14:29168984-29169006 AGGGATTATCAGCTGCAGGAAGG + Intergenic
1119466259 14:74861206-74861228 ATGGAGTTGCATATCCAGGTGGG - Intronic
1119907171 14:78316431-78316453 AGGGAGCTGGAGATGCAGGAAGG + Intronic
1121080438 14:91103515-91103537 ATGCAGAAGTAGATGTAGGAAGG - Intronic
1121992589 14:98574006-98574028 ATGGACTGTCAGATGCAGGTTGG - Intergenic
1122024782 14:98867839-98867861 ATGGAGGAGCACAGGCAGGCTGG - Intergenic
1122900201 14:104779268-104779290 ATGGAGGGGCAGGTGCAGAAAGG - Intronic
1124417878 15:29489192-29489214 AGGCAGTAGCAGAAGCAGCATGG + Intronic
1125841446 15:42804898-42804920 AGAGAATAGCAGATGCATGAGGG + Intronic
1126341210 15:47642899-47642921 ATGGAGAAGGAAATGCGGGAAGG + Intronic
1128904005 15:71451480-71451502 GGGGAGCAGCAGATGCAGGCAGG - Intronic
1129619950 15:77135230-77135252 ATAGAGTAGAAGGTGCTGGATGG + Intronic
1129915632 15:79267467-79267489 TTTGAGTAGCTGAGGCAGGAAGG + Intergenic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1132445971 15:101918944-101918966 ACAGAGTAGCAGAGGGAGGATGG + Intergenic
1132590871 16:725961-725983 AAGGAGCAGCAGCTGCAGGTGGG - Exonic
1132860960 16:2071594-2071616 ATGTAGTCGCAGACGCAGTAGGG - Exonic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1135630485 16:24032533-24032555 GTGGATTAGCAGATGGAGGTGGG + Intronic
1136030778 16:27501306-27501328 ATGGATCAGGAGAAGCAGGAAGG - Exonic
1136135984 16:28257190-28257212 ATGCAGTAGGATATGCATGAGGG - Intergenic
1137514004 16:49126704-49126726 ATAGCCTAGCAGAAGCAGGAGGG - Intergenic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1138063600 16:53917112-53917134 ATGGGGTAGCAGAGTAAGGATGG - Intronic
1140357050 16:74315383-74315405 ATGGAGTAGAATAGGGAGGAGGG - Intergenic
1140468466 16:75200891-75200913 GTGAAGTAGAAAATGCAGGAGGG + Intergenic
1140470243 16:75209701-75209723 ATGGAGTCCCAGATCCAGGCTGG + Intergenic
1141290249 16:82712025-82712047 ATGGAGTATAAAATGCAGGAAGG - Intronic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1143870279 17:9953310-9953332 AAGGAGTGGCAGAAGCAGCAGGG - Intronic
1144838459 17:18171026-18171048 CTGGAGCTGCAGATGAAGGAAGG - Intronic
1145283133 17:21482861-21482883 GTGGAGGAGCAAATGCAGGGAGG - Intergenic
1145394349 17:22482939-22482961 GTGGAGGAGCAAATGCAGGGAGG + Intergenic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1149629893 17:58114063-58114085 ATTGAGTAGAATATGCAGGAAGG - Intergenic
1149660787 17:58333010-58333032 ATGGAGGTGCTGATGCATGAAGG + Intergenic
1150453328 17:65287569-65287591 ATGGACTCGGAGATCCAGGATGG - Intergenic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1152574765 17:81135140-81135162 ATGGACCAGCAGCTGCAGAACGG - Intronic
1153235475 18:2982460-2982482 ATGGCATAGTAAATGCAGGAGGG + Intronic
1153330701 18:3870736-3870758 AAGGAGTGGAAGATGCTGGAAGG + Intronic
1153951014 18:10057706-10057728 GGGGAATAGCAAATGCAGGAAGG - Intergenic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156482613 18:37445627-37445649 ATGGGGTGGCAGATGCAGGGAGG + Intronic
1156661999 18:39357312-39357334 ATGGATTATCAGATGGAGGTTGG - Intergenic
1156882917 18:42102320-42102342 CTGGAGCAGCAGCTGAAGGAAGG - Intergenic
1157584153 18:48790647-48790669 ATGGAGGAGCAGACGAAGGGAGG + Intronic
1157989271 18:52475483-52475505 ATGGAGTTGATGATACAGGAAGG + Intronic
1159161326 18:64646627-64646649 TGGGAGTACCAGCTGCAGGAAGG - Intergenic
1159294646 18:66468559-66468581 ATGGAGTAGCATATGAATGTTGG + Intergenic
1159513161 18:69422450-69422472 ATAGAGTAGCTGGTTCAGGAGGG - Intronic
1160538927 18:79610114-79610136 ATCTAGCAGCAGATGCAGCAGGG - Intergenic
1160639336 19:114763-114785 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1161517985 19:4707355-4707377 AGGGAATGGCAGAAGCAGGATGG + Intronic
1162451009 19:10754972-10754994 ATGGACTAGAAGGGGCAGGAGGG - Intronic
1162805612 19:13136564-13136586 ATGGAGGAGCTGATACAGCAAGG + Intronic
1162805925 19:13138054-13138076 AGGGAGTCGCAGATGCTGTAGGG + Intronic
1164626462 19:29731812-29731834 CTGGAGTGGTAGGTGCAGGAGGG - Intergenic
1164776831 19:30859241-30859263 AAGGAGTAGCAGAAGTTGGATGG + Intergenic
1165159889 19:33809952-33809974 ATGGGGCAGGAGAGGCAGGATGG + Intronic
1165189254 19:34048703-34048725 ATGGAGTACAAGAAGCACGAGGG - Intergenic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166267967 19:41696654-41696676 AGGGAGAAGGTGATGCAGGAAGG + Intronic
1166273369 19:41732987-41733009 ATGAAGGAGCAGATGGATGAGGG - Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167238401 19:48328713-48328735 CTGGAGTAGCCAATGCAAGAAGG + Intronic
1167520560 19:49952039-49952061 ATGGCTTAGCAGAGGCTGGAAGG + Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
925993798 2:9275438-9275460 TGGGAGTATCAGAGGCAGGAGGG + Intronic
926525427 2:13973958-13973980 ATGAAATAGCAACTGCAGGAAGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927376427 2:22420186-22420208 ATGGAGTAATAGATGAAGTAAGG - Intergenic
927811797 2:26184575-26184597 CTGGAGCTGCAGATGCAAGAGGG + Exonic
928100158 2:28432128-28432150 TTAGAGCAGCAGATGCAGGCTGG - Intergenic
928653592 2:33426637-33426659 ATGCAGTATCAGAAGCAGCAAGG + Intergenic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
929924670 2:46198306-46198328 ATGGAAAAGCTGAGGCAGGAAGG - Intergenic
930510254 2:52335492-52335514 AAGAAGGAGCAGAAGCAGGAAGG - Intergenic
932193425 2:69761570-69761592 GTGGAGTAGCAGAAGCATCACGG - Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
934492365 2:94770267-94770289 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
935147837 2:100408321-100408343 ATGGAGTGGCGGAAGGAGGAGGG - Intronic
935416066 2:102820745-102820767 ATGAAGTTGGAGAAGCAGGAAGG + Intronic
936657520 2:114505513-114505535 GAGGAACAGCAGATGCAGGAAGG - Intronic
936783846 2:116068356-116068378 ATAGAGTAGAAGATGAAGGATGG - Intergenic
938091061 2:128435097-128435119 AGGAAGCAGCAGAAGCAGGAAGG + Intergenic
938758405 2:134401397-134401419 ATGATGTAGCAGACTCAGGAAGG - Intronic
939427187 2:142054496-142054518 GTGGAGTACGAAATGCAGGAAGG - Intronic
940097408 2:149993294-149993316 AGGAAATAGCAGAAGCAGGAAGG - Intergenic
941950827 2:171154677-171154699 ATGAAGTAGTAGAAGCAGTATGG - Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943088164 2:183340592-183340614 ATGGAGAAGAAGGTTCAGGAGGG - Intergenic
944206361 2:197162683-197162705 ATGGAGGAGGGGATGCAGGGTGG - Intronic
946773525 2:223113482-223113504 ATGGATTAGCAGCTGAAGAATGG + Intronic
948458489 2:238118210-238118232 ATGGAGCAGCAGATGGATGGAGG + Intronic
948505564 2:238425127-238425149 GTGGAGGTGCAGGTGCAGGAGGG + Intergenic
948962393 2:241350115-241350137 ATGCAGATGCAGATGCAGGGCGG + Exonic
1169325285 20:4670744-4670766 ATGGGGGAGGAGATGCAGCAAGG + Intergenic
1170673188 20:18454070-18454092 AGGGAGCAGCACATGCAGGCAGG + Intronic
1170852989 20:20020893-20020915 TTGAAGATGCAGATGCAGGAGGG + Intronic
1173031809 20:39367944-39367966 ATGAGGTAGCAGATGGGGGATGG - Intergenic
1173565329 20:44034466-44034488 ATGGAGTACCAGGAGCAGCATGG + Intronic
1174100906 20:48125515-48125537 ATGGAGCTGCAGATCCAGGGAGG - Intergenic
1174160195 20:48545173-48545195 CAGGATTAGCAGATGCTGGAAGG - Intergenic
1174390830 20:50217393-50217415 ATGGAGTGGCAGCTCCATGAGGG + Intergenic
1176845966 21:13876817-13876839 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
1177091883 21:16779615-16779637 AATAAGTAGCAGGTGCAGGAAGG + Intergenic
1177118874 21:17118050-17118072 AGGGAGAAGATGATGCAGGAAGG - Intergenic
1179292422 21:40030370-40030392 GTGGAGAAGCAAATCCAGGAAGG + Intronic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
1181442042 22:22941757-22941779 AGGGATTATCTGATGCAGGAGGG - Intergenic
1181725995 22:24811308-24811330 AGGGCGCAGCAGGTGCAGGATGG - Intronic
1182370573 22:29807466-29807488 ATGGAGTAACAGCTGAGGGAAGG + Intronic
1182890198 22:33811808-33811830 ATGGATTAGGAGACACAGGAAGG + Intronic
1182897169 22:33868542-33868564 ATGGTGTGGCAGATGCTGGCTGG - Intronic
1183111770 22:35654825-35654847 AAGAAGCAGCAGATGCAGGAAGG + Intronic
1184677194 22:46050177-46050199 ATGGGGCAGCAGCAGCAGGAGGG + Exonic
1184848478 22:47103466-47103488 TTGGAATACCAGATGCAGGGTGG + Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185330243 22:50249115-50249137 TGGGAGCAGCAGGTGCAGGAAGG + Exonic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949815683 3:8055362-8055384 CTCCAGTAGCAGATGCTGGAGGG - Intergenic
950703011 3:14762968-14762990 AAGGAGGAGCAGATGCTGAAAGG + Intronic
951487297 3:23227723-23227745 ATGGAATAGCACCTGCAGGTGGG + Intronic
952040653 3:29257402-29257424 ATGGAGTAGAACCTGCAGGGAGG - Intergenic
953162001 3:40429557-40429579 TGGGAGTAGCTGAGGCAGGAGGG + Intergenic
953879308 3:46683420-46683442 ATGGAGTAGGAGGTGGAGGGTGG - Intronic
953902738 3:46852426-46852448 ATGGAGTAGCGGTGCCAGGAAGG - Intergenic
953975244 3:47377297-47377319 GTGGAATTGCAGATGCAAGAGGG - Intergenic
954241316 3:49296033-49296055 AAAAAGTAGCAGATGCAGGCCGG + Intronic
955579965 3:60408340-60408362 GTGGATTAGGAGTTGCAGGAGGG - Intronic
956049761 3:65235373-65235395 ATGGAGTAGGAGGTGGAGGATGG - Intergenic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
957680190 3:83424018-83424040 GTGGAGTACCAGATGAAGGAAGG + Intergenic
958017566 3:87958902-87958924 ATGGAGTACCAAATGCATGGTGG - Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960194299 3:114746473-114746495 ATGCAGTAACAGATGCATGGAGG + Intronic
960224747 3:115156641-115156663 AAGAAGTAGAAGAGGCAGGAAGG - Intergenic
961035483 3:123638739-123638761 GAGGAGTAGGAGAGGCAGGAGGG - Intronic
965581938 3:170277910-170277932 ATGGAGGAACAGACGTAGGAAGG - Intronic
965786243 3:172338347-172338369 AGAGAGTATCAGAGGCAGGAAGG + Intronic
965824325 3:172715603-172715625 CTGGAGCATCAGATGCAGGGAGG + Intergenic
966537442 3:181050621-181050643 AGGGAGTTCCAGATGCAAGAGGG + Intergenic
966816981 3:183897330-183897352 ATGGAGCAGCAGATGCTGGCTGG + Intergenic
966874053 3:184311635-184311657 AGGGAGTAGCAAAGGCAAGAAGG + Intronic
967466156 3:189808305-189808327 ATGGACCAGCAGATTCAGAACGG + Exonic
967812917 3:193775542-193775564 AGGGAGTGGCAGTTGGAGGATGG - Intergenic
968463693 4:738987-739009 AGGGAGCAGCAGGTGCAGCAAGG - Intronic
969954598 4:10875573-10875595 GTGCAGTAGGAGATGCTGGAAGG - Intergenic
970239773 4:13996264-13996286 ATGGAGTAGCACATGCAGTTAGG - Intergenic
971094925 4:23389883-23389905 ATGGAGGAGCACATGAATGAAGG + Intergenic
971154291 4:24065220-24065242 TTGGAGGAGCAGATGCAGGTAGG - Intergenic
971154694 4:24068801-24068823 ATGAAGTAGAAGATGTGGGATGG - Intergenic
971779126 4:31007995-31008017 ATGGGGTAGGAGTTGCAAGAAGG + Intronic
973823559 4:54684098-54684120 ACTCAGTAGCAGAGGCAGGAAGG + Intronic
974012512 4:56619928-56619950 ATGGAGTGGCTGTTGTAGGATGG + Intergenic
975204987 4:71635226-71635248 ATGCAGTAGTAGCTGCAAGAGGG - Intergenic
975610628 4:76199244-76199266 ATGGGGTGGCAGCTGCTGGATGG - Intronic
975611049 4:76203707-76203729 ATGAAGGAACAGATGCAGGCTGG + Intronic
977585776 4:98773912-98773934 AGGGAGGAGGAGAGGCAGGAGGG - Intergenic
977969542 4:103197982-103198004 AGGGAGGAGCAGATGCCGCAAGG + Intronic
978721745 4:111918015-111918037 ATGCAGTGGCAGAGCCAGGAAGG - Intergenic
979093841 4:116519676-116519698 ATGGTCTAGCAGATGCACAAGGG + Intergenic
979105742 4:116684580-116684602 ATGAAGGTGTAGATGCAGGAGGG + Intergenic
979577427 4:122310708-122310730 GAGAAGCAGCAGATGCAGGAAGG - Intronic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980042534 4:127955646-127955668 GAGAAATAGCAGATGCAGGAAGG + Intronic
984078182 4:175209106-175209128 AAGAAACAGCAGATGCAGGAAGG - Intergenic
984515266 4:180731008-180731030 ATGGAATAGTACATGCAGGCTGG - Intergenic
985970873 5:3377478-3377500 ATGGAGATGGAGATGCAGGGAGG + Intergenic
985970882 5:3377526-3377548 ATGGAGATGGAGATGCAGGGAGG + Intergenic
985970892 5:3377574-3377596 ATGGAGATGAAGATGCAGGGAGG + Intergenic
985970901 5:3377623-3377645 ATGGAGATGGAGATGCAGGGAGG + Intergenic
986368067 5:7054900-7054922 AAGGAGTTGCAGCTGCAGCATGG - Intergenic
988919786 5:35929679-35929701 ATGAAGTAAGAGATGCAGGAAGG + Intronic
991442267 5:66663360-66663382 ATGGAGTTTCAAATGCAGAAAGG + Intronic
993307970 5:86293684-86293706 ATGGAGTTGGGGATGCAGCAAGG - Intergenic
993629815 5:90272298-90272320 ATAGACTAACAGATGGAGGAAGG + Intergenic
995347512 5:111137511-111137533 ATGGAGAAGCAGATGCTGTGTGG - Intergenic
995646698 5:114320734-114320756 ATGGAGAAGAAGATACATGAAGG - Intergenic
997051183 5:130382510-130382532 AAGAAGGATCAGATGCAGGAAGG + Intergenic
997228980 5:132229025-132229047 TGGATGTAGCAGATGCAGGAGGG - Intronic
997835257 5:137186960-137186982 AGGGAGTAACACATTCAGGAGGG - Intronic
998103613 5:139454732-139454754 ATGGAGTGGCAGATGCAGGCTGG + Intronic
1002746687 6:63169-63191 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1002757377 6:174849-174871 ATGGGGTAGTATATGCAGGTGGG + Intergenic
1002842458 6:917973-917995 ATAGAGTAGCAGTTGGAGGGAGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003846136 6:10175245-10175267 ATGGAGAAGAAAAGGCAGGAAGG - Intronic
1006794448 6:36722677-36722699 CTGGTGCAGCAGGTGCAGGAAGG - Exonic
1007305838 6:40903810-40903832 ATGGAAAAGCTGATGCATGAAGG - Intergenic
1009043847 6:58214058-58214080 ATGGAGGATCAAATGCAAGAAGG + Intergenic
1009219682 6:60968315-60968337 ATGGAGGATCAAATGCAAGAAGG + Intergenic
1009792884 6:68425999-68426021 ATAAAGGAGCATATGCAGGATGG + Intergenic
1009806697 6:68608510-68608532 TTGTAGTATCAGATGGAGGAAGG + Intergenic
1010748245 6:79588527-79588549 GAGAAGCAGCAGATGCAGGAAGG - Intergenic
1011421332 6:87176540-87176562 AGAAAGTAGCAGAAGCAGGAAGG - Intronic
1011553799 6:88554007-88554029 TTGGAGTCTCAGATGCAGGACGG - Intergenic
1013259463 6:108426831-108426853 GTGGAGTAGAAGGTGGAGGAGGG - Intronic
1014331487 6:120071209-120071231 ATGGAGTAGGAGAAGCAAGATGG - Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015427155 6:133084386-133084408 CTGGAGTAACACATGAAGGATGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016304914 6:142673689-142673711 ATTGAGTAGGGGAGGCAGGAGGG + Intergenic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1018002206 6:159589338-159589360 ATGGGGTTGCAGGTGCTGGAAGG - Intergenic
1018124592 6:160669529-160669551 ATGTAATAGCTGATGCAGGTTGG + Intergenic
1018132834 6:160748937-160748959 ATGGAACAGCTGATGCAGGTTGG - Intronic
1018517817 6:164606209-164606231 CTGGATTAGAAGATGAAGGAAGG + Intergenic
1019171748 6:170136790-170136812 GTTGAGTAGCAGGTGGAGGACGG - Intergenic
1019670355 7:2274719-2274741 ATGGCTTTGCAGATGCAGGCAGG + Intronic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020648232 7:10842332-10842354 ATGAAGTAGCAGTTGTAGGAAGG + Intergenic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1022812258 7:33881380-33881402 GTGTAGCAGCAGATGCAGGAAGG + Intergenic
1022857750 7:34332227-34332249 CTGAAGTTGCAGGTGCAGGAAGG - Intergenic
1023180917 7:37482554-37482576 ATGGAATAATAGATGCAGAAGGG - Intergenic
1023462478 7:40414343-40414365 ATTGAGTAGCATATACAGCATGG - Intronic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1030284450 7:107811428-107811450 CTGGTGTTGAAGATGCAGGAAGG - Intergenic
1031049905 7:116934609-116934631 ATAGAGTGTCAGCTGCAGGAGGG + Intergenic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1033056594 7:138060554-138060576 AGGAAGAAGCAGCTGCAGGATGG - Intronic
1033564022 7:142561220-142561242 ATGGGATGGCAAATGCAGGAGGG - Intergenic
1033564406 7:142564531-142564553 ATGGGATGGCAAATGCAGGAGGG - Intergenic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1036188534 8:6648046-6648068 ATGAACTACCAGATGCAGGTTGG - Intergenic
1037928402 8:22863192-22863214 ATGGAGAATGAGATGCAGAAAGG + Intronic
1038070299 8:24006032-24006054 ATGAAGTAAAAGTTGCAGGATGG + Intergenic
1038954829 8:32456480-32456502 ATGGAGTAGGGTATGGAGGAGGG - Intronic
1040847328 8:51857492-51857514 ATGGAGTATCAGAACCACGAAGG - Intronic
1041678652 8:60563599-60563621 AGGGAGTAGCTGAAGCAGGGTGG - Intronic
1042864469 8:73345191-73345213 ATGGAGTGGGAGATGGAGGGCGG - Intergenic
1043430754 8:80192251-80192273 ATGGTGTAGCTGATACATGATGG + Intronic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1048984949 8:139730316-139730338 CTGGGCTAGCAGATGCAGGGAGG + Intergenic
1049381903 8:142320379-142320401 GTGAAGTTGCAGGTGCAGGAGGG - Intronic
1050625770 9:7502368-7502390 AGGGACTCACAGATGCAGGAAGG + Intergenic
1051106984 9:13591627-13591649 ATGGATTGGAAGCTGCAGGAAGG - Intergenic
1052654465 9:31337101-31337123 GTGGATTAGCACATGCTGGATGG - Intergenic
1052974975 9:34403456-34403478 ATGGTGTGGGAGGTGCAGGATGG + Intronic
1054733115 9:68721517-68721539 ATATGGTAGCAGAGGCAGGAGGG + Intronic
1055600782 9:77916128-77916150 AGGGAGTAGAAGCTGAAGGATGG - Intronic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1057384200 9:94593077-94593099 ATGAGAGAGCAGATGCAGGAAGG + Intronic
1058583556 9:106483757-106483779 CTGGAGAATCAGATGCAGGGAGG - Intergenic
1059266114 9:113032613-113032635 AGGGAGCAGAAGATGAAGGAAGG + Intergenic
1059880831 9:118687104-118687126 ATGGAGTGGCTGAAGCAGGATGG - Intergenic
1060400462 9:123345939-123345961 ATTGAATAGCAGAGGAAGGAAGG + Intergenic
1061014211 9:127972608-127972630 AGCAAGTAGCAGAAGCAGGATGG + Intronic
1062171896 9:135139377-135139399 ATGGCAGAGCAGATGCTGGAAGG - Intergenic
1062568292 9:137172925-137172947 CTGGAATAGCAGGTGCAGGGAGG - Intergenic
1062619000 9:137411180-137411202 ATGGAGTAGATGATGCCGAATGG + Intronic
1062698528 9:137887540-137887562 ATAGACCAGCAGATGCAGGAAGG + Intronic
1187244676 X:17543309-17543331 ATGGAATAGGAGTTGCAGGCAGG - Intronic
1187265227 X:17726053-17726075 GTGGAGGAGAAGCTGCAGGAGGG - Exonic
1195285368 X:103377522-103377544 ATGGAGCAGCCTATGCAGAATGG + Exonic
1195654754 X:107323938-107323960 ATGGAGCACGAGAGGCAGGAGGG + Intergenic
1197927270 X:131659907-131659929 ATGGAGTACAAGATGCAAGCTGG - Intergenic
1198216817 X:134562989-134563011 GTGGACTAGAAGATCCAGGAAGG - Intergenic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1199919951 X:152389787-152389809 ATGTATTAGCTGATGCATGATGG - Intronic
1201971418 Y:19801766-19801788 ATGGAGTATGAGATGAAGCATGG + Intergenic