ID: 1032253569

View in Genome Browser
Species Human (GRCh38)
Location 7:130278911-130278933
Sequence GTCCATTGTAGGCCTGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032253569_1032253578 30 Left 1032253569 7:130278911-130278933 CCCTGGCCAGGCCTACAATGGAC 0: 1
1: 0
2: 0
3: 13
4: 96
Right 1032253578 7:130278964-130278986 GCTGAGAAAATCAAGGCCAAAGG No data
1032253569_1032253577 23 Left 1032253569 7:130278911-130278933 CCCTGGCCAGGCCTACAATGGAC 0: 1
1: 0
2: 0
3: 13
4: 96
Right 1032253577 7:130278957-130278979 TCTAGTTGCTGAGAAAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032253569 Original CRISPR GTCCATTGTAGGCCTGGCCA GGG (reversed) Intronic
900394099 1:2446114-2446136 GTCCACTGCAGTCCTAGCCAGGG + Intronic
900624661 1:3602711-3602733 GTGCCGTGGAGGCCTGGCCACGG - Intronic
901127862 1:6941841-6941863 GTCCACTATAGGCATGGCCAGGG + Intronic
903182415 1:21611620-21611642 GCCCCATGGAGGCCTGGCCAGGG - Intronic
903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG + Intronic
905174827 1:36128613-36128635 GACCGTTCTAGGCCTGGGCAGGG + Intergenic
905611926 1:39360544-39360566 GTTCAATGTAGGACTGGGCATGG + Intronic
907426817 1:54384998-54385020 CTCCAGAGTAGGCCTGGGCAGGG + Intronic
911524888 1:98972801-98972823 GGCTAGTGTAGGCCTGGGCATGG + Intronic
917144166 1:171870044-171870066 GTCCATTGAAGAACTAGCCATGG + Intronic
918142724 1:181732579-181732601 GGCCATTGAGGGCCTGGCCCTGG + Exonic
919755106 1:201061761-201061783 CTCCAAAGTAGGCCTGACCAGGG - Intronic
919794494 1:201313156-201313178 TTCCATTGTAGATCTGGCCAGGG - Exonic
920308339 1:205032975-205032997 TTCCATTTGAGGCCTGCCCAGGG + Intergenic
920416012 1:205799818-205799840 GTCCAATGTTGGCCTGGGAAAGG + Exonic
921960693 1:221030772-221030794 ATCCATTGCACCCCTGGCCAAGG + Intergenic
922887774 1:229033103-229033125 GTCCTTGGTAGGGCTTGCCAAGG - Intergenic
1063391619 10:5653231-5653253 GCCCCTTGTAGGCCTTGCCCAGG - Intronic
1065999441 10:31090608-31090630 GTACCTTGTAGGCCAGGCTAAGG + Intergenic
1066197572 10:33116044-33116066 GCCCACCGTAGGGCTGGCCACGG - Intergenic
1067156319 10:43783866-43783888 GTCCACTGTTGGCTTGGACAAGG + Intergenic
1067804311 10:49382551-49382573 GCCCAATCTAGGCCTGGGCAAGG - Intronic
1069090638 10:64195922-64195944 GTCCTTTCTAGGACTGGCCATGG - Intergenic
1069868504 10:71518928-71518950 GCCCATTGGGGGCGTGGCCAAGG + Intronic
1069895874 10:71679723-71679745 CTCGATTGCAGGGCTGGCCATGG - Intronic
1070830400 10:79414749-79414771 ATCCAGGGTGGGCCTGGCCAAGG - Intronic
1070845775 10:79521863-79521885 GTCCCTTGGAGGCTTGGCCAGGG + Intergenic
1070928018 10:80238455-80238477 GTCCCTTGGAGGCTTGGCCAGGG - Intergenic
1075811449 10:125227604-125227626 GACCTTTGTGGGCTTGGCCAAGG + Intergenic
1077515948 11:3002343-3002365 GTGCAGGGAAGGCCTGGCCAAGG - Intronic
1081434677 11:43014093-43014115 GTCCATTGATGGCCTATCCAAGG - Intergenic
1081778113 11:45690952-45690974 GTCCAAGTTAGGCCTGGGCATGG - Intergenic
1082001354 11:47395162-47395184 GGCCAAAGTAGGCCTGGCCCTGG - Intergenic
1083265987 11:61547011-61547033 CTCCATGGTCGGCCTGCCCATGG + Intronic
1083596528 11:63920497-63920519 GGCCACTGATGGCCTGGCCAGGG - Intergenic
1084380027 11:68805865-68805887 GCCCATTGTAGTCATGGCCCTGG - Intronic
1084705898 11:70815817-70815839 GCCCACTGCAGTCCTGGCCAAGG + Intronic
1088640760 11:111871089-111871111 GCCCACTCTAGGCCTGGCCCAGG + Intronic
1091837520 12:3596088-3596110 GTCCATGGAGGGCCTGGCTAAGG - Intergenic
1092191907 12:6527369-6527391 TTCCATTGCTGGCCTGGCCCCGG + Intronic
1102243373 12:111339448-111339470 GTCTCTTGTAGGGCTGGGCAAGG + Intronic
1102639330 12:114352719-114352741 GTGCATTGTGTGCCTTGCCATGG + Intergenic
1108072701 13:46644741-46644763 CCCCAGTGTAGGCCTGGGCATGG + Intronic
1110405884 13:75150071-75150093 GTCAATTGTAGGTCTGGCTAGGG - Intergenic
1110549481 13:76796201-76796223 GCACATTGTAGGCCTGGGAATGG - Intergenic
1114398144 14:22385258-22385280 GTCCATAGTAGGCATTGCCCAGG - Intergenic
1122009756 14:98736441-98736463 GTCCATGGCAGCCCAGGCCAGGG + Intergenic
1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG + Intronic
1136671583 16:31863365-31863387 GTCCCTTGTAGGCCAGTCCTTGG + Intergenic
1140969057 16:79995363-79995385 GTTCATTCTAGGCCTTGCCAAGG - Intergenic
1142054594 16:87985143-87985165 GTGCTTTGTGGGCCTCGCCAGGG + Intronic
1142282751 16:89157049-89157071 GGCCCTTCTAGCCCTGGCCAAGG + Intergenic
1147625744 17:41898711-41898733 GGCCATTGTGGGCATGGCCCTGG - Exonic
1152001442 17:77647929-77647951 ATCGATTTTAGGCCTGACCATGG - Intergenic
1159704873 18:71674625-71674647 GTCTTTTCTAGGCCTGCCCATGG - Intergenic
1161489913 19:4556184-4556206 GTCTGTTGTGGGCATGGCCAAGG + Intronic
1163826795 19:19528593-19528615 GCCAATTGTAGGCATGGCGAGGG + Intronic
927933119 2:27058414-27058436 GGCCATTGCAGCCCTGGACATGG + Exonic
929419507 2:41776409-41776431 ATCCATTCCAGGCCTGCCCATGG - Intergenic
937037419 2:118793537-118793559 GGCCACTGTAACCCTGGCCATGG - Intergenic
941638463 2:167961688-167961710 TTCCATTGTTGGTATGGCCAGGG - Intronic
1172169210 20:32918710-32918732 GAGCATTGTGGGCCTGGGCAGGG + Intronic
1172732459 20:37099409-37099431 GTGCCTTGTAGGCCAGGACAAGG - Intergenic
1173017000 20:39234773-39234795 GGTCATGGGAGGCCTGGCCAGGG + Intergenic
1175692458 20:61075456-61075478 GTCCAAAGGATGCCTGGCCAGGG - Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1178078546 21:29036626-29036648 GTCTATAGTAAGCCTGGCTAGGG - Intronic
1179162046 21:38906825-38906847 GTCCTTTGTCTTCCTGGCCATGG - Intergenic
1179399306 21:41069500-41069522 GTAAATTGTAGGGCTGGGCATGG + Intergenic
1179600806 21:42476197-42476219 GCCCAGCCTAGGCCTGGCCAGGG + Intronic
1181181475 22:21071445-21071467 GTCCATACTTGGCCTGGACAAGG + Intergenic
1182549096 22:31091427-31091449 GGCCTGTGGAGGCCTGGCCACGG - Exonic
1184200182 22:42963195-42963217 GTACATTGTGGGCCGGGGCAGGG - Intronic
950216865 3:11166474-11166496 GTACAATGTAGGCCTCACCAGGG - Intronic
962006650 3:131356433-131356455 GTCAAATGTAGGCTTGACCAGGG - Intergenic
965849690 3:173009408-173009430 GGCCTTTGTAGTCCTGGCCATGG + Intronic
966226505 3:177603762-177603784 GTCAAATGTAGGGCTGGCTAAGG + Intergenic
968626793 4:1629449-1629471 GTGCCCTGGAGGCCTGGCCAGGG + Intronic
968941042 4:3637893-3637915 GTCCTTTGCTGGCCTGGCCACGG - Intergenic
975748993 4:77503219-77503241 ATCTAATGTAGGCCGGGCCAAGG - Intergenic
975893087 4:79052331-79052353 GTCTATAATAGACCTGGCCATGG + Intergenic
975909116 4:79247711-79247733 GTGCATGGTAGTCCTGGGCAGGG - Intronic
988069831 5:26273785-26273807 GTCTATTGCAGGCATGCCCAGGG - Intergenic
997624967 5:135325273-135325295 GCCCCTTGCAGGCCTGGCTAGGG + Intronic
997699302 5:135885266-135885288 GCCCATTGTATGCCTGGCACTGG - Intronic
1002103840 5:176870219-176870241 GTGCATCGTGGGCCTGGCCCTGG + Intronic
1002603186 5:180366552-180366574 CTCCATAGTTGGGCTGGCCAGGG + Intergenic
1008113115 6:47515114-47515136 GTGCATTGTAGGTCTGGCAAAGG + Intronic
1013742100 6:113299427-113299449 GTCCCTTGTATGAGTGGCCAGGG + Intergenic
1016614218 6:146028353-146028375 GTCCCTTGCAGGCCCTGCCAGGG + Intronic
1018129769 6:160717959-160717981 ATTCATTGTAGGGCTGGGCACGG + Intronic
1018953362 6:168392614-168392636 TCACATAGTAGGCCTGGCCATGG + Intergenic
1022886013 7:34644616-34644638 GTCCATTGGAGCCCTGGTTAGGG - Intergenic
1024581642 7:50805480-50805502 GTCCTTTGAAGGGCTGGGCAGGG + Intergenic
1025904866 7:65775739-65775761 GTTCATTGTCTGCATGGCCAGGG + Intergenic
1029118045 7:98248045-98248067 GTGCTTTGTAGGCATAGCCAAGG + Intronic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1035333278 7:158110368-158110390 TTCCATGGCAGGCATGGCCATGG - Intronic
1036413691 8:8527155-8527177 GTCCATTCTAGGCGAGGCCAGGG + Intergenic
1037835753 8:22213902-22213924 GTCCAGGGTAGGCCCAGCCAGGG + Intergenic
1041246232 8:55891017-55891039 TTCCATTGTATGGCTGGGCACGG - Intronic
1046714222 8:117549568-117549590 GGCCATTGTTGGCCTGACAATGG + Intergenic
1048030167 8:130623607-130623629 GTCCATTTTAGGTCTGGCTATGG + Intergenic
1052079090 9:24180684-24180706 GTCCATTTTAGTCATGGCTAGGG + Intergenic
1052453314 9:28661352-28661374 GTCAACTGTAGGGCAGGCCAAGG - Intronic
1055402027 9:75934166-75934188 GGCCATTGCAGGCCAGCCCAAGG + Intronic
1057819223 9:98318490-98318512 GTCCTGTGCAGGGCTGGCCAGGG + Intronic
1189443830 X:41062119-41062141 CTCCATTGTGGGGCTGGGCACGG + Intergenic
1196834651 X:119802971-119802993 GTCCATTGAAGTCATGACCATGG - Intergenic
1196837846 X:119829762-119829784 GTCCATTGAAGTCATGACCATGG - Intergenic