ID: 1032259545

View in Genome Browser
Species Human (GRCh38)
Location 7:130323782-130323804
Sequence AGATCTAGGCCTCATCTTAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 77}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032259542_1032259545 4 Left 1032259542 7:130323755-130323777 CCTCTTTGCCTTTTGAACTCACT 0: 1
1: 0
2: 0
3: 25
4: 312
Right 1032259545 7:130323782-130323804 AGATCTAGGCCTCATCTTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
1032259537_1032259545 30 Left 1032259537 7:130323729-130323751 CCCCATCTGTCCTAATGGGCTTA 0: 1
1: 0
2: 0
3: 18
4: 126
Right 1032259545 7:130323782-130323804 AGATCTAGGCCTCATCTTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
1032259540_1032259545 20 Left 1032259540 7:130323739-130323761 CCTAATGGGCTTACCTCCTCTTT 0: 1
1: 0
2: 1
3: 9
4: 151
Right 1032259545 7:130323782-130323804 AGATCTAGGCCTCATCTTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
1032259543_1032259545 -4 Left 1032259543 7:130323763-130323785 CCTTTTGAACTCACTTCAAAGAT 0: 1
1: 0
2: 1
3: 22
4: 244
Right 1032259545 7:130323782-130323804 AGATCTAGGCCTCATCTTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
1032259539_1032259545 28 Left 1032259539 7:130323731-130323753 CCATCTGTCCTAATGGGCTTACC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1032259545 7:130323782-130323804 AGATCTAGGCCTCATCTTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
1032259538_1032259545 29 Left 1032259538 7:130323730-130323752 CCCATCTGTCCTAATGGGCTTAC 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1032259545 7:130323782-130323804 AGATCTAGGCCTCATCTTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
1032259541_1032259545 7 Left 1032259541 7:130323752-130323774 CCTCCTCTTTGCCTTTTGAACTC 0: 1
1: 0
2: 1
3: 23
4: 367
Right 1032259545 7:130323782-130323804 AGATCTAGGCCTCATCTTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032259545 Original CRISPR AGATCTAGGCCTCATCTTAC AGG Exonic