ID: 1032265284

View in Genome Browser
Species Human (GRCh38)
Location 7:130366164-130366186
Sequence GGTCCTCCCCAAGAATGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032265284_1032265289 20 Left 1032265284 7:130366164-130366186 CCTGTGCATTCTTGGGGAGGACC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1032265289 7:130366207-130366229 CATCATCTGAAGTGGTCCATGGG No data
1032265284_1032265288 19 Left 1032265284 7:130366164-130366186 CCTGTGCATTCTTGGGGAGGACC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1032265288 7:130366206-130366228 GCATCATCTGAAGTGGTCCATGG No data
1032265284_1032265286 12 Left 1032265284 7:130366164-130366186 CCTGTGCATTCTTGGGGAGGACC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1032265286 7:130366199-130366221 TCCTAGAGCATCATCTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032265284 Original CRISPR GGTCCTCCCCAAGAATGCAC AGG (reversed) Intronic
900616310 1:3567214-3567236 GGTCCCTCCCAGGGATGCACTGG + Intronic
901266264 1:7913199-7913221 AGTCCTGCCCATGAAGGCACCGG + Intergenic
903192825 1:21666405-21666427 GGTCCTTCCCAAGACAGGACAGG - Intronic
903288261 1:22290645-22290667 GGTCATGCCCAAGAGGGCACCGG - Intergenic
906937623 1:50227870-50227892 GGACCTCACCAATAATGCAGAGG + Intergenic
907052927 1:51341992-51342014 GGGCCTCCTCAAGAATGGAGAGG - Intronic
915906052 1:159878067-159878089 GGTCTTGCCCAAGATTGCACAGG + Intronic
1064553790 10:16528214-16528236 TGTCCTCAGCAAAAATGCACTGG + Intergenic
1066637097 10:37514577-37514599 TGTACTCCCCAAAAATGCATAGG + Intergenic
1068016484 10:51523230-51523252 GATGCTCCCCAAGCAAGCACAGG - Intronic
1071567616 10:86679899-86679921 GGATCTCCCCAAGAAGGCCCTGG - Intronic
1074457115 10:113604716-113604738 GGTCCATGCCAAGAATGCCCAGG - Exonic
1076451512 10:130560066-130560088 GGACATTCCCAAGAATGCTCTGG + Intergenic
1076827562 10:132976976-132976998 GGTCATCCCCAAGACTGCAGGGG - Intergenic
1076827579 10:132977036-132977058 GGTCATCCCCAAGACTTCAGGGG - Intergenic
1077523236 11:3048762-3048784 GGACCAGCCCAAGAAAGCACAGG + Intronic
1084965013 11:72739934-72739956 GGACCTCCCCTGGAATGCCCTGG + Intronic
1089794666 11:120970598-120970620 GCTCCTCCACAAGAATGAGCAGG - Intronic
1091436014 12:473656-473678 GGTCCTACAGAAGAATGCAAAGG + Intronic
1095628528 12:44346419-44346441 TCTCCTCCTCAAAAATGCACAGG + Intronic
1102481553 12:113227240-113227262 GGTCCCCACCAAGCATCCACAGG - Intronic
1105641172 13:22266432-22266454 TGTCCTCCCCAAAACTCCACTGG + Intergenic
1119860580 14:77933237-77933259 GGTCCTTCTGAAGAATGAACAGG - Exonic
1121779602 14:96613844-96613866 GGTCCTCCCCAGGTTTGCAGAGG - Intergenic
1122345535 14:101056439-101056461 CTTCTTCCCCAGGAATGCACTGG - Intergenic
1125230840 15:37453224-37453246 GGAGCTGCCCAAGAATGCAGTGG + Intergenic
1128151262 15:65364917-65364939 GGTCCTCCCCTAGGAAACACTGG - Intronic
1131698773 15:94909980-94910002 GGCCCTCCCCAACCATGCCCAGG - Intergenic
1135256123 16:20942780-20942802 GGTCATCACAAAGAGTGCACTGG + Intronic
1145954302 17:28843880-28843902 TGACCTCGCCTAGAATGCACTGG + Intronic
1146314483 17:31796443-31796465 GTTCCTCCCCAAGAATCCCTGGG + Intergenic
1153179189 18:2413659-2413681 GGTGAGCCCCAAGACTGCACAGG + Intergenic
1154092458 18:11378342-11378364 AGGCCTCCCCAGGACTGCACAGG - Intergenic
1154356317 18:13625122-13625144 GAGGCTCCCCAACAATGCACAGG - Intronic
1156242586 18:35267941-35267963 GGTCCTGCCCACGAATGCCGAGG + Intronic
1157439317 18:47697841-47697863 GGTCCTCCTCAACAATTCTCAGG + Intergenic
1157669595 18:49517217-49517239 AGTACTCCCCAAGCATGAACTGG - Intergenic
1157726700 18:49969918-49969940 TGTCCTCCGCAAGAATGGGCTGG + Intronic
1158609325 18:58924286-58924308 GTTCCTACCCCAGAAAGCACAGG - Intronic
1160247165 18:77168160-77168182 TGTCCTGACCAAGGATGCACTGG + Intergenic
1162942735 19:14023190-14023212 GGTCTTGCCCAAGGATACACAGG + Intergenic
1164449542 19:28348588-28348610 GATCCACTCCAAGAGTGCACTGG + Intergenic
1168516443 19:57013420-57013442 GGACCTCACCAAGATTGCCCTGG + Intergenic
925036868 2:693681-693703 AGTCCTCCACAAGAAATCACGGG - Intergenic
927515025 2:23667124-23667146 GGTTCTCACCAAGAATTCATAGG + Intronic
932144765 2:69307333-69307355 GGTCCTGCCCTAGACTGCGCTGG + Intergenic
932332044 2:70903336-70903358 AGGCCTCCCCAAGAAAGGACAGG - Intronic
934659639 2:96136411-96136433 GGTGCTTCCCAGGAAAGCACTGG + Intronic
934715472 2:96540563-96540585 AAACCTCCCCAAGAAAGCACAGG + Intronic
937311065 2:120903837-120903859 GTTCCTCCCCAAGGATCCAGAGG + Intronic
938248458 2:129796449-129796471 GGTCACCCCCAAGAAGGCCCTGG - Intergenic
946033329 2:216722549-216722571 GGTCCTCCACAAATATGTACTGG - Intergenic
947959061 2:234219513-234219535 GGGCCTCAGCCAGAATGCACAGG - Intergenic
1173221738 20:41137410-41137432 GGTCCTCCCCACGGGTGCGCGGG + Intronic
1180782620 22:18529428-18529450 GGTCCTTCTCAAGAATGAACTGG + Exonic
1180858696 22:19064441-19064463 GGTTCCCCCCAAGAAAGCAAGGG - Intronic
1181126177 22:20703455-20703477 GGTCCTTCTCAAGAATGAACTGG + Intergenic
1181239510 22:21468766-21468788 GGTCCTTCTCAAGAATGAACTGG + Intergenic
1183735708 22:39643728-39643750 CAGCCTCCCCAAGAAAGCACTGG - Intronic
1185218795 22:49618460-49618482 GCTCCACCCAAAGAATGCAGAGG + Intronic
949509860 3:4758438-4758460 GCTCCTCCCCTAGAATGGTCTGG + Intronic
953238926 3:41131009-41131031 GGTGCTCCCCAAGAACCCTCTGG - Intergenic
953882744 3:46700131-46700153 AGTCCTCCCCAGGCATGCCCTGG - Intergenic
956022211 3:64945087-64945109 GGTCCTACCCAAGAAGGAAAGGG + Intergenic
963438991 3:145312651-145312673 TTTCCTCCCCATGAATTCACAGG - Intergenic
968393958 4:215961-215983 TGTAATCCCCAAGAATGCAGAGG + Intergenic
968410990 4:389795-389817 TGTAATCCCCAAGAATGCAGAGG + Intergenic
969342250 4:6549521-6549543 GGTCGTGCCCAGGAAGGCACAGG - Intronic
971283895 4:25268333-25268355 GGTTCTCCCCAAAAAAGGACAGG - Intronic
976467643 4:85389025-85389047 CGTCCTCCCCATGTCTGCACGGG + Intergenic
982088768 4:151862320-151862342 GGTCCTCCCCAACAAATAACTGG - Intergenic
986029991 5:3884563-3884585 AGTCCTCACCGAGATTGCACAGG - Intergenic
986032459 5:3906848-3906870 GCTTCTCCCCAAAAATGCATGGG + Intergenic
989321532 5:40140412-40140434 GGTCTTCCCAAAACATGCACTGG - Intergenic
998462959 5:142323131-142323153 GGCCCTACCCAATATTGCACTGG - Intronic
1001776949 5:174336255-174336277 GTGCCTCCCGAAGAATGCTCAGG - Intergenic
1004206323 6:13594704-13594726 GGTGCTCCCCAAGGAAGGACTGG + Intronic
1004807296 6:19217654-19217676 CGTCCTCCCCAAAACTGCAGTGG + Intergenic
1018442446 6:163825550-163825572 GGTTCTCCCCAAGGAAGAACTGG - Intergenic
1019512384 7:1424176-1424198 GGCCCTCCCCAGGCCTGCACTGG - Intergenic
1019891045 7:3946742-3946764 GGTGTTACCCAAGAATGCAGCGG + Intronic
1022484506 7:30767902-30767924 TGTCCTCCCCATGTCTGCACGGG - Intronic
1026607194 7:71826258-71826280 AGTCGACCCCCAGAATGCACTGG + Intronic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1030456134 7:109776314-109776336 GGTCCTCCACAAAAATGTGCAGG + Intergenic
1032265284 7:130366164-130366186 GGTCCTCCCCAAGAATGCACAGG - Intronic
1043143115 8:76616243-76616265 GCTCCTCCCCATCAATGCATTGG + Intergenic
1048337572 8:133514530-133514552 GGTGCTCCCCAGGAAAGGACTGG - Intronic
1051188310 9:14483756-14483778 GTTCCTCAACAATAATGCACAGG + Intergenic
1051499099 9:17757967-17757989 GGTCCTCCATAATAATGCCCAGG - Intronic
1062305626 9:135905483-135905505 AGCCATGCCCAAGAATGCACTGG + Intronic
1188791606 X:34413322-34413344 AGAGCTCCCAAAGAATGCACTGG + Intergenic
1190628820 X:52365438-52365460 GGACCTCCCTGTGAATGCACAGG + Intergenic
1196464423 X:115958256-115958278 GCTCCTCCCCAGGCAAGCACAGG + Intergenic
1200835595 Y:7728251-7728273 TGTCCTCCTCATGAATGCTCAGG - Intergenic