ID: 1032267436

View in Genome Browser
Species Human (GRCh38)
Location 7:130379431-130379453
Sequence CTGTGTCAGGACCCCGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032267436_1032267440 2 Left 1032267436 7:130379431-130379453 CCAAGGTCGGGGTCCTGACACAG No data
Right 1032267440 7:130379456-130379478 CAGAGCCTCTAGATGGTGCTGGG No data
1032267436_1032267448 29 Left 1032267436 7:130379431-130379453 CCAAGGTCGGGGTCCTGACACAG No data
Right 1032267448 7:130379483-130379505 CCCTGGGGGGCCCGTGAATGAGG No data
1032267436_1032267442 12 Left 1032267436 7:130379431-130379453 CCAAGGTCGGGGTCCTGACACAG No data
Right 1032267442 7:130379466-130379488 AGATGGTGCTGGGAAAGCCCTGG No data
1032267436_1032267439 1 Left 1032267436 7:130379431-130379453 CCAAGGTCGGGGTCCTGACACAG No data
Right 1032267439 7:130379455-130379477 GCAGAGCCTCTAGATGGTGCTGG No data
1032267436_1032267443 13 Left 1032267436 7:130379431-130379453 CCAAGGTCGGGGTCCTGACACAG No data
Right 1032267443 7:130379467-130379489 GATGGTGCTGGGAAAGCCCTGGG No data
1032267436_1032267444 14 Left 1032267436 7:130379431-130379453 CCAAGGTCGGGGTCCTGACACAG No data
Right 1032267444 7:130379468-130379490 ATGGTGCTGGGAAAGCCCTGGGG No data
1032267436_1032267446 16 Left 1032267436 7:130379431-130379453 CCAAGGTCGGGGTCCTGACACAG No data
Right 1032267446 7:130379470-130379492 GGTGCTGGGAAAGCCCTGGGGGG No data
1032267436_1032267438 -5 Left 1032267436 7:130379431-130379453 CCAAGGTCGGGGTCCTGACACAG No data
Right 1032267438 7:130379449-130379471 CACAGAGCAGAGCCTCTAGATGG No data
1032267436_1032267445 15 Left 1032267436 7:130379431-130379453 CCAAGGTCGGGGTCCTGACACAG No data
Right 1032267445 7:130379469-130379491 TGGTGCTGGGAAAGCCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032267436 Original CRISPR CTGTGTCAGGACCCCGACCT TGG (reversed) Intergenic
No off target data available for this crispr