ID: 1032267583

View in Genome Browser
Species Human (GRCh38)
Location 7:130380018-130380040
Sequence TCCCCAAGGCAGCTTCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032267583_1032267592 23 Left 1032267583 7:130380018-130380040 CCTGCCTGAAGCTGCCTTGGGGA No data
Right 1032267592 7:130380064-130380086 TGCTCGATCACCGGAATGAAAGG No data
1032267583_1032267593 27 Left 1032267583 7:130380018-130380040 CCTGCCTGAAGCTGCCTTGGGGA No data
Right 1032267593 7:130380068-130380090 CGATCACCGGAATGAAAGGCTGG No data
1032267583_1032267588 14 Left 1032267583 7:130380018-130380040 CCTGCCTGAAGCTGCCTTGGGGA No data
Right 1032267588 7:130380055-130380077 AGCCCCACTTGCTCGATCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032267583 Original CRISPR TCCCCAAGGCAGCTTCAGGC AGG (reversed) Intergenic
No off target data available for this crispr